Search
Advanced Search
Metrics info
Average Rating (0 User Ratings)
    • Currently 0/5 Stars.
    See all categories
      • Currently 0/5 Stars.
      • Currently 0/5 Stars.
      • Currently 0/5 Stars.
    Rate This Article
Share this Article info
  • Bookmark: StumbleUpon Facebook Connotea CiteULike Bibliography
Public Library of Science

Open Access

Research Article

TGF-β Signaling Controls Embryo Development in the Parasitic Flatworm Schistosoma mansoni

Author Summary

Schistosomes are parasitic worms that infect hundreds of millions of people in developing countries. They cause disease by virtue of the fact that the eggs that they produce, which are intended for release from the host in order to allow transmission of infection, can become trapped in target organs such as the liver, where they induce damaging inflammation. Egg production by female schistosomes is critically dependent on the presence of male parasites, without which females never fully develop, and (counterintuitively) on the contribution of signals from the host's immune system. Very little is understood about the molecular basis of these interactions. Here, we describe a newly discovered schistosome gene, which is expressed in the reproductive tract of the female parasite and in parasite eggs. The protein encoded by this gene is made only when females are paired with males in an immunologically competent setting. Using recently developed tools that allow gene function to be inhibited in schistosomes, we show that the product of this gene plays a crucial role in egg development. Examining how the expression of this gene is controlled has the potential to provide insight into the molecular nature of the interactions between male and female parasites and their hosts. Moreover, the pivotal role of this gene in the egg makes it a potential target for blocking transmission and disease development.

Tori C. Freitas, Euihye Jung, Edward J. Pearce*

1 Department of Pathobiology, School of Veterinary Medicine, University of Pennsylvania, Philadelphia, Pennsylvania, United States of America

Abstract Top

Over 200 million people have, and another 600 million are at risk of contracting, schistosomiasis, one of the major neglected tropical diseases. Transmission of this infection, which is caused by helminth parasites of the genus Schistosoma, depends upon the release of parasite eggs from the human host. However, approximately 50% of eggs produced by schistosomes fail to reach the external environment, but instead become trapped in host tissues where pathological changes caused by the immune responses to secreted egg antigens precipitate disease. Despite the central importance of egg production in transmission and disease, relatively little is understood of the molecular processes underlying the development of this key life stage in schistosomes. Here, we describe a novel parasite-encoded TGF-β superfamily member, Schistosoma mansoni Inhibin/Activin (SmInAct), which is key to this process. In situ hybridization localizes SmInAct expression to the reproductive tissues of the adult female, and real-time RT-PCR analyses indicate that SmInAct is abundantly expressed in ovipositing females and the eggs they produce. Based on real-time RT-PCR analyses, SmInAct transcription continues, albeit at a reduced level, both in adult worms isolated from single-sex infections, where reproduction is absent, and in parasites from IL-7R−/− mice, in which viable egg production is severely compromised. Nevertheless, Western analyses demonstrate that SmInAct protein is undetectable in parasites from single-sex infections and from infections of IL-7R−/− mice, suggesting that SmInAct expression is tightly linked to the reproductive potential of the worms. A crucial role for SmInAct in successful embryogenesis is indicated by the finding that RNA interference–mediated knockdown of SmInAct expression in eggs aborts their development. Our results demonstrate that TGF-β signaling plays a major role in the embryogenesis of a metazoan parasite, and have implications for the development of new strategies for the treatment and prevention of an important and neglected human disease.

Author Summary Top

Schistosomes are parasitic worms that infect hundreds of millions of people in developing countries. They cause disease by virtue of the fact that the eggs that they produce, which are intended for release from the host in order to allow transmission of infection, can become trapped in target organs such as the liver, where they induce damaging inflammation. Egg production by female schistosomes is critically dependent on the presence of male parasites, without which females never fully develop, and (counterintuitively) on the contribution of signals from the host's immune system. Very little is understood about the molecular basis of these interactions. Here, we describe a newly discovered schistosome gene, which is expressed in the reproductive tract of the female parasite and in parasite eggs. The protein encoded by this gene is made only when females are paired with males in an immunologically competent setting. Using recently developed tools that allow gene function to be inhibited in schistosomes, we show that the product of this gene plays a crucial role in egg development. Examining how the expression of this gene is controlled has the potential to provide insight into the molecular nature of the interactions between male and female parasites and their hosts. Moreover, the pivotal role of this gene in the egg makes it a potential target for blocking transmission and disease development.

Introduction Top

Amongst the Bilateria, transforming growth factor–β (TGF-β) signaling is recognized as playing an essential role in embryogenesis in deuterostomes and in arthropod protostomes, but its role in lophotrochozoan protostomes is unclear [1]. Schistosomes, the causative agents of schistosomiasis, one of the major neglected tropical diseases [2,3], are metazoan parasites that belong to the lophotrochozoan phylum Platyhelminthes.

Components of TGF-β signaling have been molecularly characterized in metazoans throughout the animal kingdom. Activation of this pathway begins at the cell surface when a dimeric ligand binds a complex consisting of types I and II receptor serine/threonine kinases [4]. Upon ligand binding, the constitutively active type II receptor phosphorylates and activates the type I receptor, which then phosphorylates cytoplasmic Smad proteins that translocate to the nucleus, where they mediate gene expression [4]. Components of a functional TGF-β pathway(s), including one type I receptor [5] (Schistosoma mansoni receptor kinase-1 [SmRK1], S. mansoni transforming growth factor–β type I receptor [SmTβ RI]), one type II receptor [6,7] (SmRK2, SmTβ RII), and three Smads [810], have been identified in S. mansoni, with nearly all components localized to either the surface of the worm or reproductive tissues of the female [59,11]. Nevertheless, while nearly the entire transcriptome of S. mansoni has been examined with the identification of 163,000 expressed sequence tags (ESTs) [12], a ligand of parasite origin for the TGF-β pathway(s) has remained elusive. This has led to the hypothesis that the ligands for schistosome TGF-β receptors are of host origin [5,13,14], and a suggestion that host TGF-β, signaling through SmRK2, plays a role in the pairing of male and female parasites [7].

Sexually mature S. mansoni live within the mesenteric vasculature, where each female produces approximately 300 eggs each day. Transmission of schistosomiasis depends upon the release of parasite eggs from the human host. Development of an immature egg into a mature egg containing a miracidium, the stage of the parasite that invades the intermediate fresh water snail host, occurs outside of the female worm, and takes approximately 5 d. Many of the eggs produced by schistosomes fail to reach the external environment, but instead become trapped in host tissues, where pathological changes caused by the immune responses to secreted egg antigens cause disease [15]. Despite the central importance of egg production in transmission and disease, and recent advances in proteomics and transcriptomics [12,1618], essentially nothing is known of the molecular pathways involved in embryogenesis in schistosomes.

In this study, we describe the cloning and characterization of a S. mansoni TGF-β homolog, S. mansoni Inhibin/Activin (SmInAct). Although we found SmInAct to be expressed in adult male and female parasites, and in eggs, the localization of SmInAct expression to the reproductive organs of female parasites focused our attention on the role of this gene in egg production. A role for SmInAct in reproduction was supported by analyses of female parasites recovered from infertile infections, in which we found that SmInAct protein was undetectable. Confirmation of the importance of this TGF-β superfamily member in the reproductive process was obtained from RNA interference (RNAi) studies, in which targeted knockdown of SmInAct in female worms or directly in the eggs that they produce resulted in a marked cessation of embryogenesis.

Results Top

Cloning and Sequence Analysis of SmInAct

SmInAct was identified through a tblastn search of the Wellcome Trust's Sanger Institute's S. mansoni genome sequence using the C-terminal region of the Drosophila melanogaster dActivin sequence. We were unable to identify SmInAct in EST databases regardless of whether we searched using the coding or 3′–untranslated region (UTR) sequences. The 5′ and 3′ ends of SmInAct were amplified via rapid amplification of cDNA ends (RACE) using primers designed from within putative coding sequence and adult S. mansoni cDNA as template. The 1.3-kb, full-length SmInAct transcript contains 10 base pairs (bp) of 5′UTR, 808 bp of 3′UTR, and a poly-A tail. The deduced amino acid sequence of SmInAct is 161 residues long and contains many of the molecular hallmarks for a TGF-β, including a putative basic proteolytic cleavage site located at position 32 as RQRR where the bioactive, C-terminal domain (126 amino acids) is enzymatically separated from the N-terminal pro-domain. Nine invariant cysteine moieties, and invariant proline and glycine residues (Figure 1A) essential for the proper dimerization and tertiary structure of a TGF-β homolog, are all predicted in SmInAct. The deduced amino acid sequence of SmInAct contains one putative N-linked glycosylation site at position 110. Within the bioactive domain, SmInAct is 27% identical to both DAF-7 from Caenorhabditis elegans and dActivin from D. melanogaster, and 29% identical to human TGF-β 1 (Figure 1A). Phylogenetic analysis of SmInAct among other TGF-β superfamily members groups this homolog with members of the TGF-β/Activin subfamily (Figure 1B), and further clusters SmInAct phylogenetically with TGF-β homologs from the free-living nematode C. elegans (DAF-7) and the parasitic nematodes Brugia malayi (Bm-TGH-2) and Strongyloides stercoralis (Ss-TGH-1).

thumbnail

Figure 1. SmInAct Is a Member of the TGF-β/Activin Subfamily

(A) ClustalW alignment of the C-terminal domain of the SmInAct protein with three other members of the TGF-β/Activin subfamily. Amino acids identical to the SmInAct sequence are shaded gray. Numbers to the right indicate position of the last amino acid in the row within each respective full-length sequence. Stars indicate invariant amino acid residues in TGF-β homologs.

(B) Phylogenetic dendrogram demonstrating that SmInAct is a member of the TGF-β superfamily. SmInAct (red) is shown clustering among members of the TGF-β/Activin subfamily (solid line), and not with members of the BMP/growth differentiation factor subfamily (dashed line). Conserved residues in the C-terminal region of each homolog (final 94–106 amino acids) were used in the analysis. Percentages at branch points are based on 1,000 bootstrap runs.

doi:10.1371/journal.ppat.0030052.g001

SmInAct Transcript and Protein Expression and Localization

To determine the expression of SmInAct at the transcript level, real-time reverse transcriptase–polymerase chain reaction (RT-PCR) was performed on cDNA from eggs, adult male parasites, and adult female parasites from mixed-sex infections. As seen in Figure 2A, SmInAct is expressed in all stages tested at relatively similar levels. Western analyses using polyclonal antibodies against recombinant SmInAct were used to determine the protein expression profile of SmInAct. The anti-SmInAct serum recognized a 28-kDa protein in egg antigen extracts and a doublet (32 kDa and 28 kDa) in adult male and female extracts (Figure 2B, lanes 1–3); these bands presumably represent the unprocessed (32 kDa) inactive and processed (28 kDa) active forms of the molecule. The relative molecular weights of the two bands recognized by anti-SmInAct antiserum in parasite extracts are larger than that predicted by the sequence, presumably due to detergent and reducing agent-resistant dimerization, and/or to glycosylation at amino acid 110. Glycosylation plays an important role in the solubility and secretion of other members of the TGF-β superfamily [19,20]. Eggs appear to contain only the lower molecular weight, putatively active form of SmInAct. To localize SmInAct within the parasite, we performed in situ hybridization on sections of adult worms. Anti-sense probes localized SmInAct transcripts to the reproductive tissues of the adult female, with strong signals in the vitellaria and ovary (Figure 2C), whereas in adult males, SmInAct transcripts localized to various subtegumental regions (Figure 2D).

thumbnail

Figure 2. SmInAct Expression Is Linked to Reproductive Capability

(A) SmInAct is expressed in the egg, adult male, and adult female. The RNA tested is indicated on the x-axis, and the y-axis represents the ratio of SmInAct cDNA relative to α-tubulin cDNA (reference gene), as determined by real time RT-PCR. Data are presented as mean ratios (+/− standard deviation [s.d.]) from three separate experiments. There is no significant difference in SmInAct expression among the stages tested.

(B) SmInAct protein is detectable in eggs, adult males, and adult females from mixed-sex infections in wild-type mice, but is not detectable in females or males from single-sex infections, or in females or males from mixed-sex infections of IL-7R−/− mice.

(C) SmInAct transcript is localized to the reproductive tissues of the adult female, including the ovary (O) and vitellaria (V) (left panel, in situ hybridization with anti-sense probe) A serial section was probed with sense-strand SmInAct and over-developed (right panel). G, gut. Scale bar = 110 μm.

(D) SmInAct transcript is localized to subtegumental regions of the adult male, with concentrations of expression around the oral sucker (O.S.) and ventral sucker (V.S.) (left panel, in situ hybridization with anti-sense probe). A serial section was probed with sense-strand SmInAct and over-developed (right panel). Scale bar = 110 μm.

(E) SmInAct mRNA levels are significantly lower in females isolated from single-sex infections or from IL-7R−/− mice than in females isolated from infected wild-type mice. SmInAct mRNA levels were measured by real-time RT-PCR. Data are presented as mean fold change in expression (+/− s.d.) from two RNA extractions.

(F) SmInAct mRNA levels in males isolated from single-sex infections or from IL-7R−/− mice compared to mRNA levels in wild-type mice. SmInAct mRNA levels were measured by real-time RT-PCR. Data are presented as mean fold change in expression (+/− s.d.) from two RNA extractions. There is no significant difference in SmInAct expression in males from single-sex infections or from IL-7R−/− mice versus males isolated from mixed-sex infection of wild-type mice.

doi:10.1371/journal.ppat.0030052.g002

The expression pattern in the female suggested a role for SmInAct in egg production. We focused on this possibility, and reasoned that if this were the case, SmInAct expression might be diminished in unfertile females. In vivo, successful oogenesis requires the presence of male schistosomes [21], and, for reasons that have remained unclear, an intact CD4+ T lymphocyte compartment within the host [22]. Therefore, we analyzed SmInAct expression in female parasites from mice harboring single-sex infections, and in parasites from severely lymphopenic interleukin-7 receptor knockout (IL-7R−/−) mice carrying mixed-sex infections, which produce a significant number of dead eggs [23,24]. Real-time RT-PCR demonstrated that SmInAct mRNA levels were significantly decreased, but not absent, in females from these infections (Figure 2E). Of particular interest, SmInAct protein was undetectable by Western analyses in females from single-sex infections as well as from infections of IL-7R−/− mice (Figure 2B).

While the localization of SmInAct transcripts to the male subtegumental region is not immediately informative in terms of function in the male, we nevertheless noted that male parasites recovered from infertile infections in IL-7R−/− mice were similar to female parasites in terms of transcriptional and post-transcriptional regulation of SmInAct expression (Figure 2B and 2F). Moreover, this was also the case for male parasites recovered from male single-sex infections (Figure 2B and 2F).

RNAi-Mediated Knockdown of SmInAct Expression

To gain a better understanding of the function of SmInAct and the signaling pathway it activates, this TGF-β homolog was targeted for knockdown via RNAi [2527]. Pairs of adult males and females recovered from infected mice were soaked in double-stranded RNA (dsRNA) corresponding to SmInAct (1 μg/ml) or an irrelevant control dsRNA (luciferase) for 1 wk in vitro, followed by RNA extraction and real-time RT-PCR analyses. SmInAct dsRNA–treated worms showed a consistent and significant decrease in SmInAct expression of >40% when compared to SmInAct expression in worms soaked in the irrelevant control dsRNA (Figure 3A). No consistently significant difference in the numbers of eggs produced by control versus SmInAct dsRNA–treated worm pairs was observed, suggesting that SmInAct is not important for egg production per se. However, in examining these cultures, we noted that eggs produced by SmInAct dsRNA–treated parasites failed to develop (unpublished data). To specifically address the role of SmInAct in egg development, we treated eggs directly with SmInAct dsRNA. Approximately 20% of eggs laid by adult parasites during the first 2 d of in vitro culture will develop over the ensuing 5 d to contain miracidia [28], with a typical progression of development through six stages illustrated in Figure 3B. Therefore, eggs produced by worm pairs for the first 2 d ex vivo were collected and soaked in dsRNA (1 μg/ml) corresponding to SmInAct or an irrelevant dsRNA for 5 d, and their development was scored. Relative to eggs soaked in an irrelevant dsRNA, where ~20% of the eggs developed through stage 6, eggs treated with SmInAct dsRNA aborted development at stage 2 (Figure 3C and 3D). An absence of SmInAct transcripts (Figure S1), and a nearly 10-fold decrease in SmInAct protein (Figure 3E), were associated with the failure of SmInAct dsRNA–treated eggs to develop. This phenotype was not observed when eggs were treated with dsRNA corresponding to luciferase, a sequence not encoded in the schistosome genome (Figure 3C and 3D), or to S. mansoni cathepsin B1 (SmCB1), a cathepsin B detectable in eggs (Table 1).

thumbnail

Figure 3. SmInAct Is Essential for Egg Development

(A) Treatment of adult parasites with dsRNA corresponding to SmInAct led to a 40% reduction in SmInAct mRNA levels. dsRNA treatment is indicated on the x-axis, where control worms were treated with luciferase dsRNA. Data are presented as the mean fold change in SmInAct expression (+/− s.d.) from three separate experiments, as determined by real-time RT-PCR using paramyosin as a reference gene for expression.

(B) Developmental progression of eggs laid in vitro. Eggs produced by paired males and females during the first 48 h ex vivo were cultured in vitro for 5 d, and an egg from the developing majority was photographed. Stages of development approximate progressive 20-h periods. Scale bar = 110 μm.

(C) Immature eggs produced by adult parasites ex vivo and soaked in SmInAct dsRNA failed to develop into miracidia. Eggs soaked in an irrelevant control dsRNA (luciferase, 1 μg/ml) developed through stage 6 within 5 d (left) while eggs soaked in SmInAct dsRNA (1 μg/ml) for the same period halted development at stage 2 (right). Main scale bar = 210 μm. Inset scale bar = 110 μm.

(D) Quantitative analysis of the SmInAct dsRNA–induced developmental phenotype. Control- or SmInAct dsRNA–treated eggs were examined microscopically and scored as either developed or undeveloped based on the presence or absence of a miracidium. Data are presented as mean percent developed (+/− s.d.) from four separate experiments.

(E) SmInAct protein levels are decreased by approximately 10-fold following treatment with SmInAct dsRNA. Protein extacts from 350 control or SmInAct dsRNA–treated eggs were separated via SDS-PAGE in 10-fold serial dilutions, blotted, and probed with anti-SmInAct antiserum. A silver-stained sister SDS-PAGE gel is shown to confirm protein loading.

doi:10.1371/journal.ppat.0030052.g003
thumbnail

Table 1.

Comparsion of the Development of Eggs Soaked in SmInAct dsRNA versus SmCB1 dsRNA

doi:10.1371/journal.ppat.0030052.t001

Discussion Top

Multiple components of a TGF-β signaling pathway have been characterized in S. mansoni, but a ligand of parasite origin for the pathway has remained elusive. Additionally, while functions in host–parasite interactions have been proposed based on the expression of receptors on the parasite surface, and on the responsiveness of the parasite receptors to host TGF-β [57,14], the function that TGF-β signaling plays in S. mansoni has remained unclear. In this study, we report the expression of SmInAct, a TGF-β–like ligand in the parasitic flatworm S. mansoni, the production of which is coupled to the reproductive potential of the worms. We provide evidence that SmInAct plays a crucial role in embryogenesis.

Understanding of the developmental processes regulated by TGF-β in invertebrates is based largely on data from the model organisms D. melanogaster and C. elegans. Decapentaplegic, a bone morphogenetic protein (BMP)–like homolog in D. melanogaster, acts as a morphogen by determining cell fate along the dorsal–ventral axis in a gradient-dependent manner [29]. Also in D. melanogaster, a type I receptor, baboon, stimulates cellular proliferation and is essential for normal embryonic development [30]. Presumably, SmInAct could be fulfilling functions in the schistosome egg analogous to these known roles for decapentaplegic and/or baboon. None of the three characterized TGF-β homologs in C. elegans are important for patterning or growth of the embryo [3133]; however, two TGF-β homologs have yet to be examined (tig-2 and Y46E12BL.1), and, intriguingly, serial analysis of gene expression (SAGE) tags for both homologs have been found in the C. elegans embryo [34]. Like the other C. elegans TGF-β homologs that are resistant to RNAi affects, tig-2 and Y46E12BL.1 have no phenotype in genome-wide RNAi screens [35,36]; therefore, direct mutagenesis will likely be required to determine the function of these genes.

The identification of SmInAct, a TGF-β superfamily member, as a key component of egg development in S. mansoni, a member of the Platyhelminthes, the earliest branch of the Bilateria [37], underscores the central role played by this pathway in embryogenesis. While one type I and one type II TGF-β receptor have been characterized for S. mansoni, there appears to be at least three type I receptors and two type II receptors present in the genome based on a preliminary blast search for homologs. It will be important to delineate which of the S. mansoni type I and type II TGF-β receptors are involved in SmInAct signaling and to identify the Smads important for transmitting the signal induced by this growth factor. Furthermore, identifying the genes regulated by SmInAct signaling will provide information regarding the precise function that this growth factor serves in egg maturation, as well as the functions the pathway may serve in other life stages of the parasite, including the adult male.

SmInAct protein was not detectable in infertile females recovered from single-sex infections or from IL-7R−/− mice, despite the fact that these parasites contained SmInAct transcripts (although at lower levels than in fecund parasites). This strongly indicates that SmInAct is both transcriptionally and post-transcriptionally regulated by worms of the opposite sex as well as by signals from the host. It is well established that parasites recovered from hosts lacking CD4+ T cells are developmentally stunted and produce significantly fewer fertile eggs than those recovered from mixed-sex infections of immunocompetent hosts. Translation of SmInAct mRNA is the first identified molecular process downstream of the effect of the host immune system on schistosome development [2224], and as such, could open the way towards an increased understanding of this unusual feature of schistosome biology. The finding that the production of SmInAct in males is under the same constraints as in females is curious and perhaps indicates an additional function(s) for SmInAct in S. mansoni. We are unaware of a link between the site of expression of SmInAct in the male schistosome and reproductive events, and further work is required to elucidate the function of SmInAct in male worms.

In other settings, the uncoupling of transcription and translation is linked to the activation of the integrated stress response [3841]. This mechanism, conserved in eukaryotes, re-programs cells to conserve energy in response to stress signals such as amino acid deficiency and oxidative stress by restricting the translation of transcripts requiring an active translation initiation complex [3841]. Limited cellular energy is then used for the expression of genes necessary to maintain cell viability [42]. In this context, parasites in single-sex infections and in mice lacking CD4+ T cells may be considered stressed due to the lack of signals received from the opposite sex and immunocompetent host, thereby restricting the translation of non-essential transcripts. SmInAct protein expression may be considered expendable considering the role it plays in embryogenesis rather than in crucial cellular functions linked to the survival of the adult worm. A more thorough investigation of the S. mansoni homologs of translation factors involved in the stress response and of the regulation of other transcripts and protein expression will be required to evaluate this possibility.

Post-transcription regulation of eukaryotic transcripts is controlled in part by the 3′UTR [43]. This region can bind elements (including microRNAs and proteins) that inhibit the translation and/or decrease mRNA stability. For example, 3′UTRs of several mammalian cytokines contain adenosine- and uridine-rich elements (AREs) that bind ARE-binding proteins (ARE-BPs) (reviewed in [44]). The binding of ARE-BPs to these transcripts causes either rapid decay or inhibits their translation. While AREs are somewhat divergent in sequence, they often contain the consensus “AUUUA” and are found in a uridine-rich environment. Interestingly, the long 3′UTR of SmInAct has two exact repeats of “UUUCTAUUUA” that contain the consensus “AUUUA” ARE (underlined). Furthermore, the 3′UTR of SmInAct is U-rich (43% uridines). It will be interesting to determine whether these repeats, or other regions of the long 3′UTR, play a role in the post-transcriptional regulation of SmInAct expression.

It is of interest when considering the relationship of schistosomes with their mammalian hosts to note that in other systems, TGF-β superfamily members have been shown to function across phylum boundaries [45,46]. For example, the Drosophila BMP homologs DPP and 60A are able to induce bone development when injected into the skin of rats [45], and mammalian BMP-4 can rescue Drosophila DPP mutants [46]. Consequently, we believe that it is feasible that SmInAct could act as a ligand to initiate signaling in host cells. It is clear that proteins produced by eggs have distinct immunomodulatory functions [47], and SmInAct could conceivably participate in these effects if secreted/excreted from the schistosome egg. Our identification of SmInAct as a cytokine that is molecularly conserved between host and parasite, coupled with the description of an effective method for altering gene expression in the schistosome egg, allows these and other issues to now be addressed. Despite recent advances in vaccine design [48], a solution for schistosomiasis remains an elusive goal. Current attempts to control schistosomiasis depend on repeated administration of one drug, praziquantel, with no replacements waiting in the wings should resistance develop. Understanding how schistosome eggs develop could provide targets for intervention in the schistosome life cycle and for blocking disease progression.

Materials and Methods Top

Parasites and animals.

The Puerto Rican/NMRI strain of S. mansoni was used in all experiments. Adult schistosomes were recovered by hepatic-portal perfusion from C57BL/6 female mice or B6 IL-7R−/− (The Jackson Laboratory, http://www.jax.org) that had each been percutaneously exposed to ~60 cercariae 8 wk earlier. Adult parasites and eggs laid were maintained in vitro in M199 (Gibco, http://www.invitrogen.com), 10% fetal calf serum, 1% Antibiotic/Antimycotic (Gibco), and 1% HEPES in a 37 °C/5% CO2 atmosphere as previously described [11,28].

Isolation of full-length SmInAct cDNA from S. mansoni.

The C-terminal, translated region of the Drosophila activin homolog (dActivin) (amino acids 565–669) was used to search the Wellcome Trust's Sanger Institute's S. mansoni genome assembly using the tblastn algorithm. A contig (0020320) with significant similarity to dActivin was identified. Full-length cDNA corresponding to SmInAct was isolated using total RNA (1 μg) from adult parasites and the SuperScript III GeneRacer 5′ and 3′ RACE kit (Invitrogen, http://www.invitrogen.com) as per manufacturer's instructions. Gene-specific primers were designed for isolation of the 5′-end (5′-GGTTCAAAACTTTTCGGGTGTA-3′) and 3′-end (5′-AATCTTGTTGTCATCCAACTCAA-3′) of SmInAct and used in RT-PCR with GeneRacer 5′ and 3′ primers according to manufacturer's suggestions. Resulting amplicons were cloned into the TOPO cloning vector (Invitrogen) and sequenced. To verify the full-length sequence of SmInAct, primers designed from the 5′ and 3′ ends of the transcript were used in RT-PCR, and the resulting fragment was cloned and sequenced.

Sequence analysis.

Sequence similarities between the deduced amino acid sequence of SmInAct and other members of the TGF-β superfamily were determined through multiple sequence alignments using the ClustalW algorithm, as well as the Align 2 sequences (bl2seq) program at the National Center for Biotechnology Information (http://www.ncbi.nlm.nih.gov). An unrooted phylogram was drawn using amino acids within the conserved C-terminal domain of SmInAct, and known TGF-β superfamily members and distances were drawn using the Dayhoff Pam matrix and neighbor-joining algorithm in the PHYLIP software package developed by J. Felsenstein, University of Washington, Seattle, Washington, United States (http://evolution.genetics.washington.edu​/phylip.html ). Percentages at branch points are based on 1,000 bootstrap runs.

Real-time RT-PCR.

Total RNA was extracted from parasites using Qiagen's RNeasy Mini kit (http://www.qiagen.com), and contaminating genomic DNA was removed by DNase treatment using the Turbo DNA-free endonuclease (Ambion, http://www.ambion.com). First-strand cDNA was synthesized using 500 ng of RNA, SuperScript II reverse transcriptase (Invitrogen), and oligo dT as a primer. RT-minus controls were performed to confirm the absence of genomic DNA (unpublished data).

SmInAct transcript levels in egg and adult stages were quantified relative to α-tubulin using Applied Biosystems' 7500 real-time PCR system and SYBR green PCR Master Mix (Applied Biosystems, http://www.appliedbiosystems.com). Total reaction volume was 10 μl with 300 nM of each primer, 5 μl of SYBR green PCR Master Mix, and 0.5 μl of cDNA as template (or water as a negative control). SmInAct primers were: forward 5′-AATCTTGTTGTCATCCAACTCAA-3′ and reverse 5′-AACTACAAGCACATCCTAAAACAA-3′. α-Tubulin primers were: forward 5′-CCAGCAAATCAGATGGTGAA-3′ and reverse 5′-TTGACATCCTTGGGGACAAC-3′. PCR efficiency (E) was determined for both primer sets by plotting cycle thresholds from a 10-fold serial dilution of cDNA and inputting the slope in the equation E = 10(−1/slope). For expression analyses, quantification of SmInAct transcript relative to α-tubulin was calculated using the equation: ratio = (ESmα-tubulin)CT/(ESmInAct)CT where ESmα-tubulin is the PCR efficiency of the reference gene, ESmInAct is the PCR efficiency of target gene, and CT is the cycle threshold. For analysis of RNAi-induced knockdown, quantification of SmInAct transcript relative to paramyosin (paramyosin primers were: forward 5′-CGTGAAGGTCGTCGTATGGT-3′ and reverse 5′-GACGTTCAAATTTACGTGCTTG-3′) was calculated using the 2−ΔΔCt method. Dissociation curves were generated for each real-time RT-PCR to verify the amplification of only one product.

Recombinant SmInAct expression, antiserum production, and Western analyses.

Eco RI (forward) and Xho I (reverse) tagged primers were designed to amplify the C-terminal bioactive region of SmInAct (forward 5′-GGAATTCTCATTAACTAAAGGAGATGA-3 and reverse 5′-CCGCTCGAGTTAACTACAAGCACATCCTA-3′). The amplified product was cloned into the expression vector pET28a+ (Novagen, http://www.emdbiosciences.com) and sequenced to verify the absence of any mutations. Expression of recombinant SmInAct was induced in Escherichia coli BL21(DE3) by addition of 1 mM IPTG when cultures reached an OD600 of 0.5 at 37 °C, followed by 3 hours of shaking at room temperature. Recombinant SmInAct was expressed in bacteria as insoluble inclusion bodies. Exhaustive attempts to refold the protein using gluathione and reduced glutathione proved unsuccessful. We therefore purified the protein via nickel column chromatography under denaturing conditions (6 M urea) as per the manufacturer's protocol (Novagen). Antiserum was generated by Cocalico Biologicals (http://www.cocalicobiologicals.com) through subcutaneous inoculation of a rabbit with 100 μg of purified protein in complete Freund's adjuvant, followed by three boosts of 50 μg in incomplete Freund's adjuvant on days 14, 21, and 49, followed by exsanguinations on day 64.

For detection of SmInAct protein, 10 μg of protein extracted from eggs, adult males, and adult females via Dounce homogenizing in lysis buffer (1% Triton-X 100, 20 mM HEPES, 10% glycerol, 150 mM NaCl) supplemented with a protease inhibitor cocktail (Sigma, http://www.sigmaaldrich.com) were separated by SDS-PAGE, electroblotted, and probed with anti-SmInAct antiserum (1:10,000), pre-immune serum (1:10,000), or a monoclonal antibody (4B1) against paramyosin. Affinity purified HRP-conjugated goat anti-rabbit IgG (Cell Signaling Technology, http://www.cellsignal.com) was used to detect bound rabbit antibodies, while an affinity purified HRP-conjugated horse anti-mouse IgG (Cell Signaling Technology) was used to detect the anti-paramyosin monoclonal antibody. The secondary antibodies were detected using ECL reagents as per manufacturer's instructions (GE Healthcare, http://www.gehealthcare.com).

In situ hybridization.

Localization of SmInAct in 5-μm sections of adult S. mansoni was performed as previously described [49]. DIG-labeled sense and anti-sense transcripts were generated using Roche's DIG RNA labeling mix (http://www.roche.com) as per manufacturer's instructions with T7-tagged amplicons as template (sense: forward 5′-TAATACGACTCACTATAGGGTTGATCCAAAAAAGGTT​GTTATGG-3′, reverse 5′-TTAACTACAAGCAGCTCCTA −3′; anti-sense: forward 5′-ATAATATGTAATAATTGTGA −3′ reverse 5′- TAATACGACTCACTATAGGGAACTACAAGCACATCCTAAA​ACAA-3′). The hybridized DIG-probes were detected using an alkaline-phosphatase conjugated anti-DIG antibody (Roche), and visualized using NBT (337.5 μg/ml) and BCIP (175 μg/ml) in 0.1M Tris-HCl, 0.1M NaCl, 0.05 MgCl2. Worm sections were photographed using a Leica DMIRB microscope and DC500 camera (Leica, http://www.leica.com).

dsRNA synthesis and RNA interference.

dsRNA was synthesized using the T7 Megascript kit (Ambion) as per manufacturer's instructions. T7-tagged primers were used to generate a 381-bp SmInAct-dsRNA template encompassing the active ligand domain (forward 5′-TAATACGACTCACTATAGGGCGATCATTAACTAAAGG​AGATGAG-3′, reverse 5′-TAATACGACTCACTATAGGGAACTACAAGCACATCCT​AAAACAA-3′). Luciferase and SmCB1 dsRNAs (negative controls) were generated as described [25]. For dsRNA treatment of worms, five adult pairs were cultured in the presence of 1 μg/ml dsRNA for 7 d with medium and dsRNA changes occurring every other day. For dsRNA treatment of eggs, five adult pairs were cultured as above (in the absence of dsRNA) for 2 d, worms were removed, and dsRNA was added at 1 μg/ml. Eggs were photographed using a Leica DMIRB microscope and DC500 camera.

Statistical analyses.

Student t-test was used for statistical analyses of dsRNA-induced knockdown of SmInAct expression, change in expression of SmInAct in single-sex and IL-7R−/− mice, and egg developmental phenotypes (control versus SmInAct dsRNA). Chi-square analyses were used to test the statistical significance of the egg developmental phenotype. The Yates correction was applied because we specified only two categories: undeveloped and developed (Table 1).

Supporting Information Top

Figure S1. SmInAct Transcript Is Not Detectable in SmInAct dsRNA–Treated Eggs

SmInAct mRNA levels in eggs treated with SmInAct dsRNA or control dsRNA for 5 d were measured using real time RT-PCR using paramyosin as a reference gene for expression. dsRNA treatment is indicated on the x-axis. Data are presented as the mean fold change in SmInAct expression. N/D = not detected. In this experiment, paramyosin mRNA was detectable in the SmInAct dsRNA–treated eggs. However, in most experiments in which eggs were treated with SmInAct dsRNA, it was not possible to recover mRNA from which reference transcripts could be detected by RT-PCR. Eggs treated with control dsRNA always yielded high quality mRNA.

(560 KB TIF)

Accession Numbers

Sequence data reported in this manuscript are available from GenBank (http://www.ncbi.nlm.nih.gov/Genbank) under accession number DQ863513. Other GenBank accession numbers of genes and sequences used in this study include: B. malayi TGH-1 (AAB71839); B. malayi TGH-2 (AAD19903); C. elegans DAF-7 (NP_497265); C. elegans DBL-1 (NP_504709); Danio rerio Activinβ A isoform 2 (AAX68505); D. melanogaster Activin (NP_651942); D. melanogaster dActivin (AF454392); D. melanogaster decapentaplegic (NP_477311); Homo sapiens Activinβ E (NP_113667); H. sapiens BMP-2 (NP_001191); H. sapiens BMP-3 (NP_001192); H. sapiens BMP-4 (NP_031580); H. sapiens BMP-5 (NP_066551); H. sapiens BMP-6 (NP_001709); H. sapiens BMP-7 (NP_001710); H. sapiens BMP-8 (NP_861525); H. sapiens GDF-5 (NP_000548); H. sapiens GDF-6 (NP_001001557); H. sapiens GDF-7 (NP_878248); H. sapiens GDF-10 (NP_004953); H. sapiens Inhibinβ A precursor (NP_002183); H. sapiens Inhibinβ B (NP_002184); H. sapiens Inhibinβ C (NP_005529); H. sapiens TGF-β 1 (NP_000651); H. sapiens TGF-β 2 (NP_003229); H. sapiens TGF-β 3 (NP_003230); Mus musculus BMP-2 (NP_031579); M. musculus BMP-3 (NP_775580); M. musculus BMP-4 (NP_031580); M. musculus GDF-10 (NP_665684); M. musculus Inhibinβ A (NP_032406); M. musculus Inhibinβ B (NP_032407); M. musculus TGF-β 1 (NP_035707); M. musculus TGF-β 2 (NP_033393); M. musculus TGF-β 3 (NP_033394); S. mansoni α-tubulin (M80214); S. mansoni paramyosin (M35499); and Strongyloides stercoralis TGH-1 (AAV84743).

Acknowledgments Top

We thank Jason Correnti, Erika Pearce, and Sparky Lok for their advice and encouragement. Schistosome life stages used in this research were supplied by the National Institute of Allergy and Infectious Diseases (NIAID) Schistosomiasis Resource Center at the Biomedical Research Institute (Rockville, Maryland, United States) through NIAID Contract NO1-AI-30026.

Author Contributions Top

TCF and EJP conceived and designed the experiments, analyzed the data, and wrote the paper. TCF and EJ performed the experiments and contributed reagents/materials/analysis tools.

References Top

  1. Herpin A, Lelong C, Favrel P (2004) Transforming growth factor-beta-related proteins: An ancestral and widespread superfamily of cytokines in metazoans. Dev Comp Immunol 28: 461–485. Find this article online
  2. Chitsulo L, Engels D, Montresor A, Savioli L (2000) The global status of schistosomiasis and its control. Acta Trop 77: 41–51. Find this article online
  3. Sachs JD, Hotez PJ (2006) Fighting tropical diseases. Science 311: 1521. Find this article online
  4. Massague J, Blain SW, Lo RS (2000) TGFbeta signaling in growth control, cancer, and heritable disorders. Cell 103: 295–309. Find this article online
  5. Davies SJ, Shoemaker CB, Pearce EJ (1998) A divergent member of the transforming growth factor beta receptor family from Schistosoma mansoni is expressed on the parasite surface membrane. J Biol Chem 273: 11234–11240. Find this article online
  6. Forrester SG, Warfel PW, Pearce EJ (2004) Tegumental expression of a novel type II receptor serine/threonine kinase (SmRK2) in Schistosoma mansoni. Mol Biochem Parasitol 136: 149–156. Find this article online
  7. Osman A, Niles EG, Verjovski-Almeida S, LoVerde PT (2006) Schistosoma mansoni TGF-β Receptor II: Role in host ligand-induced regulation of a schistosome target gene. PLoS Pathog 2: e54. doi:10.1371/journal.ppat.0020054.
  8. Osman A, Niles EG, LoVerde PT (2001) Identification and characterization of a Smad2 homologue from Schistosoma mansoni, a transforming growth factor-beta signal transducer. J Biol Chem 276: 10072–10082. Find this article online
  9. Osman A, Niles EG, LoVerde PT (2004) Expression of functional Schistosoma mansoni Smad4: Role in Erk-mediated transforming growth factor beta (TGF-beta) down-regulation. J Biol Chem 279: 6474–6486. Find this article online
  10. Beall MJ, McGonigle S, Pearce EJ (2000) Functional conservation of Schistosoma mansoni Smads in TGF-beta signaling. Mol Biochem Parasitol 111: 131–142. Find this article online
  11. Knobloch J, Rossi A, Osman A, LoVerde PT, Klinkert MQ, et al. (2004) Cytological and biochemical evidence for a gonad-preferential interplay of SmFKBP12 and SmTbetaR-I in Schistosoma mansoni. Mol Biochem Parasitol 138: 227–236. Find this article online
  12. Verjovski-Almeida S, DeMarco R, Martins EA, Guimaraes PE, Ojopi EP, et al. (2003) Transcriptome analysis of the acoelomate human parasite Schistosoma mansoni. Nat Genet 35: 148–157. Find this article online
  13. Beall MJ, Pearce EJ (2002) Transforming growth factor-beta and insulin-like signalling pathways in parasitic helminths. Int J Parasitol 32: 399–404. Find this article online
  14. Beall MJ, Pearce EJ (2001) Human transforming growth factor-beta activates a receptor serine/threonine kinase from the intravascular parasite Schistosoma mansoni. J Biol Chem 276: 31613–31619. Find this article online
  15. Pearce EJ, MacDonald AS (2002) The immunobiology of schistosomiasis. Nat Rev Immunol 2: 499–511. Find this article online
  16. Curwen RS, Ashton PD, Johnston DA, Wilson RA (2004) The Schistosoma mansoni soluble proteome: A comparison across four life-cycle stages. Mol Biochem Parasitol 138: 57–66. Find this article online
  17. Braschi S, Wilson RA (2006) Proteins exposed at the adult schistosome surface revealed by biotinylation. Mol Cell Proteomics 5: 347–356. Find this article online
  18. Braschi S, Curwen RS, Ashton PD, Verjovski-Almeida S, Wilson A (2006) The tegument surface membranes of the human blood parasite Schistosoma mansoni: a proteomic analysis after differential extraction. Proteomics 6: 1471–1482. Find this article online
  19. Brunner AM, Lioubin MN, Marquardt H, Malacko AR, Wang WC, et al. (1992) Site-directed mutagenesis of glycosylation sites in the transforming growth factor-beta 1 (TGF beta 1) and TGF beta 2 (414) precursors and of cysteine residues within mature TGF beta 1: Effects on secretion and bioactivity. Mol Endocrinol 6: 1691–1700. Find this article online
  20. Jones WK, Richmond EA, White K, Sasak H, Kusmik W, et al. (1994) Osteogenic protein-1 (OP-1) expression and processing in Chinese hamster ovary cells: Isolation of a soluble complex containing the mature and pro-domains of OP-1. Growth Factors 11: 215–225. Find this article online
  21. Shaw JR, Erasmus DA (1981) Schistosoma mansoni: An examination of the reproductive status of females from single sex infections. Parasitology 82: 121–124. Find this article online
  22. Davies SJ, Grogan JL, Blank RB, Lim KC, Locksley RM, et al. (2001) Modulation of blood fluke development in the liver by hepatic CD4+ lymphocytes. Science 294: 1358–1361. Find this article online
  23. Wolowczuk I, Nutten S, Roye O, Delacre M, Capron M, et al. (1999) Infection of mice lacking interleukin-7 (IL-7) reveals an unexpected role for IL-7 in the development of the parasite Schistosoma mansoni. Infect Immun 67: 4183–4190. Find this article online
  24. Davies SJ, McKerrow JH (2003) Developmental plasticity in schistosomes and other helminths. Int J Parasitol 33: 1277–1284. Find this article online
  25. Correnti JM, Brindley PJ, Pearce EJ (2005) Long-term suppression of cathepsin B levels by RNA interference retards schistosome growth. Mol Biochem Parasitol 143: 209–215. Find this article online
  26. Skelly PJ, Da'dara A, Harn DA (2003) Suppression of cathepsin B expression in Schistosoma mansoni by RNA interference. Int J Parasitol 33: 363–369. Find this article online
  27. Boyle JP, Wu XJ, Shoemaker CB, Yoshino TP (2003) Using RNA interference to manipulate endogenous gene expression in Schistosoma mansoni sporocysts. Mol Biochem Parasitol 128: 205–215. Find this article online
  28. Michaels RM, Prata A (1968) Evolution and characteristics of Schistosoma mansoni eggs laid in vitro. J Parasitol 54: 921–930. Find this article online
  29. Ferguson EL, Anderson KV (1992) Decapentaplegic acts as a morphogen to organize dorsal-ventral pattern in the Drosophila embryo. Cell 71: 451–461. Find this article online
  30. Brummel T, Abdollah S, Haerry TE, Shimell MJ, Merriam J, et al. (1999) The Drosophila activin receptor baboon signals through dSmad2 and controls cell proliferation but not patterning during larval development. Genes Dev 13: 98–111. Find this article online
  31. Ren P, Lim CS, Johnsen R, Albert PS, Pilgrim D, et al. (1996) Control of C. elegans larval development by neuronal expression of a TGF-beta homolog. Science 274: 1389–1391. Find this article online
  32. Suzuki Y, Yandell MD, Roy PJ, Krishna S, Savage-Dunn C, et al. (1999) A BMP homolog acts as a dose-dependent regulator of body size and male tail patterning in Caenorhabditis elegans. Development 126: 241–250. Find this article online
  33. Colavita A, Krishna S, Zheng H, Padgett RW, Culotti JG (1998) Pioneer axon guidance by UNC-129, a C. elegans TGF-beta. Science 281: 706–709. Find this article online
  34. McKay SJ, Johnsen R, Khattra J, Asano J, Baillie DL, et al. (2003) Gene expression profiling of cells, tissues, and developmental stages of the nematode C. elegans. Cold Spring Harb Symp Quant Biol 68: 159–169. Find this article online
  35. Sonnichsen B, Koski LB, Walsh A, Marschall P, Neumann B, et al. (2005) Full-genome RNAi profiling of early embryogenesis in Caenorhabditis elegans. Nature 434: 462–469. Find this article online
  36. Kamath RS, Fraser AG, Dong Y, Poulin G, Durbin R, et al. (2003) Systematic functional analysis of the Caenorhabditis elegans genome using RNAi. Nature 421: 231–237. Find this article online
  37. Hausdorf B (2000) Early evolution of the bilateria. Syst Biol 49: 130–142. Find this article online
  38. Zhang P, McGrath BC, Reinert J, Olsen DS, Lei L, et al. (2002) The GCN2 eIF2alpha kinase is required for adaptation to amino acid deprivation in mice. Mol Cell Biol 22: 6681–6688. Find this article online
  39. Williams BR (1999) PKR; a sentinel kinase for cellular stress. Oncogene 18: 6112–6120. Find this article online
  40. Lu L, Han AP, Chen JJ (2001) Translation initiation control by heme-regulated eukaryotic initiation factor 2alpha kinase in erythroid cells under cytoplasmic stresses. Mol Cell Biol 21: 7971–7980. Find this article online
  41. Harding HP, Novoa I, Zhang Y, Zeng H, Wek R, et al. (2000) Regulated translation initiation controls stress-induced gene expression in mammalian cells. Mol Cell 6: 1099–1108. Find this article online
  42. Harding HP, Calfon M, Urano F, Novoa I, Ron D (2002) Transcriptional and translational control in the Mammalian unfolded protein response. Annu Rev Cell Dev Biol 18: 575–599. Find this article online
  43. Pesole G, Mignone F, Gissi C, Grillo G, Licciulli F, et al. (2001) Structural and functional features of eukaryotic mRNA untranslated regions. Gene 276: 73–81. Find this article online
  44. Espel E (2005) The role of the AU-rich elements of mRNAs in controlling translation. Semin Cell Dev Biol 16: 59–67. Find this article online
  45. Sampath TK, Rashka KE, Doctor JS, Tucker RF, Hoffmann FM (1993) Drosophila transforming growth factor beta superfamily proteins induce endochondral bone formation in mammals. Proc Natl Acad Sci U S A 90: 6004–6008. Find this article online
  46. Padgett RW, Wozney JM, Gelbart WM (1993) Human BMP sequences can confer normal dorsal-ventral patterning in the Drosophila embryo. Proc Natl Acad Sci U S A 90: 2905–2909. Find this article online
  47. Pearce EJ, Kane CM, Sun J (2006) Regulation of dendritic cell function by pathogen-derived molecules plays a key role in dictating the outcome of the adaptive immune response. Chem Immunol Allergy 90: 82–90. Find this article online
  48. Tran MH, Pearson MS, Bethony JM, Smyth DJ, Jones MK, et al. (2006) Tetraspanins on the surface of Schistosoma mansoni are protective antigens against schistosomiasis. Nat Med 12: 835–840. Find this article online
  49. Kapp K, Knobloch J, Schussler P, Sroka S, Lammers R, et al. (2004) The Schistosoma mansoni Src kinase TK3 is expressed in the gonads and likely involved in cytoskeletal organization. Mol Biochem Parasitol 138: 171–182. Find this article online
Post Your Note (For Public Viewing)
Compose Your Note
 
Declare any competing interests.
Add a note to this text.
Please follow our guidelines for notes and comments and review our competing interests policy. Comments that do not conform to our guidelines will be promptly removed and the user account disabled. The following must be avoided:
  • Remarks that could be interpreted as allegations of misconduct
  • Unsupported assertions or statements
  • Inflammatory or insulting language
Add a note to this text.
You must be logged in to add a note to an article. You may log in by clicking here or cancel this note.
Add a note to this text.
You cannot annotate this area of the document. Close
Add a note to this text.
You cannot create an annotation that spans different sections of the document; please adjust your selection.
Close
Rate This Article
Please follow our guidelines for rating and review our competing interests policy. Comments that do not conform to our guidelines will be promptly removed and the user account disabled. The following must be avoided:
  1. Remarks that could be interpreted as allegations of misconduct
  2. Unsupported assertions or statements
  3. Inflammatory or insulting language
Compose Your Annotation
 
Declare any competing interests.

All site content, except where otherwise noted, is licensed under a Creative Commons Attribution License.