Search
Advanced Search
Metrics info
Average Rating (0 User Ratings)
    • Currently 0/5 Stars.
    See all categories
      • Currently 0/5 Stars.
      • Currently 0/5 Stars.
      • Currently 0/5 Stars.
    Rate This Article
Share this Article info
  • Bookmark: StumbleUpon Facebook Connotea CiteULike Bibliography
Public Library of Science

Open Access

Research Article

Deletion of IL-4Rα on CD4 T Cells Renders BALB/c Mice Resistant to Leishmania major Infection

Author Summary

Leishmaniasis is a disease induced by a protozoan parasite and transmitted by the sandfly. Several forms of infection are identified, and the different diseases have wide-ranging symptoms from localized cutaneous sores to visceral disease affecting many internal organs. Animal models of human cutaneous leishmaniasis have been established in which disease is induced by infecting mice subcutaneously with Leishmania major. Different strains of inbred mice have been found to be susceptible or resistant to L. major infection. “Healer” C57BL/6 mice control infection with transient lesion development. The protective response to infection in this strain is dominated by type 1 cytokines inducing parasite killing by nitric oxide. Conversely, “nonhealer” BALB/c mice are unable to control infection and develop nonhealing lesions associated with a dominant type 2 immune response driven by cytokines IL-4 and IL-13. However, mice deficient in IL-4/IL-13 signaling are not protected against development of cutaneous leishmaniasis. Here we describe a BALB/c mouse where the ability to polarize to a dominant type 2 response is removed by cell-specific deletion of the receptor for IL-4/IL-13 on CD4+ T cells. These mice are resistant to L. major infection similar to C57BL/6 mice, which highlights the role of T helper 2 cells in driving susceptibility and the protective role of IL-4/IL-13 signaling in non-CD4+ T cells in BALB/c mice.

Magdalena Radwanska1#, Antony J. Cutler1#, J. Claire Hoving1, Stefan Magez1,2, Christoph Holscher1, Andreas Bohms1, Berenice Arendse1, Richard Kirsch1, Thomas Hunig3, James Alexander4, Paul Kaye5, Frank Brombacher1*

1 Division of Immunology, Institute of Infectious Disease and Molecular Medicine, University of Cape Town, Cape Town, South Africa, 2 VIB, Vrije Universiteit Brussel, Brussels, Belgium, 3 Institute for Virology and Immunobiology, University of Wurzburg, Wurzburg, Germany, 4 Strathclyde Institute of Pharmacy and Biomedical Sciences, University of Strathclyde, Glasgow, United Kingdom, 5 Immunology and Infection Unit, Department of Biology, University of York, York, United Kingdom

Abstract Top

Effector responses induced by polarized CD4+ T helper 2 (Th2) cells drive nonhealing responses in BALB/c mice infected with Leishmania major. Th2 cytokines IL-4 and IL-13 are known susceptibility factors for L. major infection in BALB/c mice and induce their biological functions through a common receptor, the IL-4 receptor α chain (IL-4Rα). IL-4Rα–deficient BALB/c mice, however, remain susceptible to L. major infection, indicating that IL-4/IL-13 may induce protective responses. Therefore, the roles of polarized Th2 CD4+ T cells and IL-4/IL-13 responsiveness of non-CD4+ T cells in inducing nonhealer or healer responses have yet to be elucidated. CD4+ T cell–specific IL-4Rα (LckcreIL-4Rα−/lox) deficient BALB/c mice were generated and characterized to elucidate the importance of IL-4Rα signaling during cutaneous leishmaniasis in the absence of IL-4–responsive CD4+ T cells. Efficient deletion was confirmed by loss of IL-4Rα expression on CD4+ T cells and impaired IL-4–induced CD4+ T cell proliferation and Th2 differentiation. CD8+, γδ+, and NK–T cells expressed residual IL-4Rα, and representative non–T cell populations maintained IL-4/IL-13 responsiveness. In contrast to IL-4Rα−/lox BALB/c mice, which developed ulcerating lesions following infection with L. major, LckcreIL-4Rα−/lox mice were resistant and showed protection to rechallenge, similar to healer C57BL/6 mice. Resistance to L. major in LckcreIL-4Rα−/lox mice correlated with reduced numbers of IL-10–secreting cells and early IL-12p35 mRNA induction, leading to increased delayed type hypersensitivity responses, interferon-γ production, and elevated ratios of inducible nitric oxide synthase mRNA/parasite, similar to C57BL/6 mice. These data demonstrate that abrogation of IL-4 signaling in CD4+ T cells is required to transform nonhealer BALB/c mice to a healer phenotype. Furthermore, a beneficial role for IL-4Rα signaling in L. major infection is revealed in which IL-4/IL-13–responsive non-CD4+ T cells induce protective responses.

Author Summary Top

Leishmaniasis is a disease induced by a protozoan parasite and transmitted by the sandfly. Several forms of infection are identified, and the different diseases have wide-ranging symptoms from localized cutaneous sores to visceral disease affecting many internal organs. Animal models of human cutaneous leishmaniasis have been established in which disease is induced by infecting mice subcutaneously with Leishmania major. Different strains of inbred mice have been found to be susceptible or resistant to L. major infection. “Healer” C57BL/6 mice control infection with transient lesion development. The protective response to infection in this strain is dominated by type 1 cytokines inducing parasite killing by nitric oxide. Conversely, “nonhealer” BALB/c mice are unable to control infection and develop nonhealing lesions associated with a dominant type 2 immune response driven by cytokines IL-4 and IL-13. However, mice deficient in IL-4/IL-13 signaling are not protected against development of cutaneous leishmaniasis. Here we describe a BALB/c mouse where the ability to polarize to a dominant type 2 response is removed by cell-specific deletion of the receptor for IL-4/IL-13 on CD4+ T cells. These mice are resistant to L. major infection similar to C57BL/6 mice, which highlights the role of T helper 2 cells in driving susceptibility and the protective role of IL-4/IL-13 signaling in non-CD4+ T cells in BALB/c mice.

Introduction Top

Experimental Leishmania major infection is widely used to explore the control of T helper 1 (Th1)/Th2 differentiation and elucidate mechanisms underlying susceptibility/resistance to intracellular microbial infection [1,2]. Typically, susceptible BALB/c mice infected subcutaneously with L. major develop severe pathology, manifested by progressive lesion development, necrosis, and death, while resistant C57BL/6 mice are able to control and heal dermal lesions [3]. Nonhealing disease in BALB/c mice is associated with a Th2 response characterized by secretion of mainly IL-4, IL-5, IL-9, and IL-13 [2,47], high anti-Leishmania antibody titres, arginase-1 production by macrophages [8,9] and visceral dissemination of parasites [10]. In contrast, resistance to L. major infection is mediated by development of a protective Th1 response, in which sustained IL-12 production, interferon-γ (IFN-γ) release and macrophage killing via effector nitric oxide (NO) production catalyzed by inducible NO synthase (iNOS) underlie protective responses [9,1114].

CD4 T cell–derived cytokines drive L. major responses, and, as such, events that control T cell differentiation in response to L. major appear to be critical for disease outcome [15]. Disruption of Th1 differentiation by neutralization of IL-12 renders resistant C57BL/6 mice susceptible, whereas susceptible BALB/c mice treated with IL-12 become resistant to L. major infection [12]. IL-12 production must be sustained to control infection [13]. While both resistant and susceptible mice produce IL-4 early after infection [16,17], production of this cytokine is sustained in susceptible mice and transient in resistant mice [1618]. Neutralization of IL-4 allowed control of L. major infection in BALB/c mice [19]. Subsequent studies in knockout mice proved that IL-4 was indeed important but not the sole mediator of susceptibility in BALB/c mice. L. major infection was controlled in BALB/c IL-4−/− mice, but parasite burdens remained greater than those of resistant animals [6,20]. These observations remain controversial, with some laboratory strains developing IL-4–independent susceptibility and indicating that further factors are involved [21]. IL-13 has been implicated as a susceptibility factor in L. major infection [4]. Susceptible IL-13 transgenic C57BL/6 mice develop impaired IL-12 and IFN-γ production during acute leishmaniasis, while IL-13−/− BALB/c mice remain comparatively resistant [4,22]. IL-13 can influence Th1 differentiation by modulating macrophage function and suppressing secretion of NO, IL-12, and/or IL-18 [22,23], partially attributed to IL-4/IL-13 activated alternative macrophages (aaMphs), recently demonstrated in mice deficient for this activation status [9,24].

IL-4 and IL-13 share a common signaling pathway through the IL-4 receptor α (IL-4Rα) chain. A functional IL-4R (type I) requires assembly of IL-4Rα with a γc chain, while interaction of IL-4Rα with an IL-13Rα1 subunit leads to formation of a functional IL-13 receptor (type II) [25]. IL-4Rα–deficient mice therefore lack responsiveness to IL-4 and IL-13. Careful analysis of footpad swelling and lesion development showed that initial control of L. major infection is equivalent in IL-4−/− and IL-4Rα−/− BALB/c mice. However, in contrast to IL-4−/− mice, IL-4Rα−/− mice develop progressive chronic disease. These data clearly indicate a protective role for IL-13 signaling in protection against chronic L. major infection, at least in the absence of IL-4 responsiveness [20].

Expression of IL-4Rα reflects the pleiotropic nature of IL-4 biology, as this receptor subunit is expressed upon a wide range of cells [26]. Given the central role of T cells in controlling L. major infection [15] and of IL-4 in driving Th2 responses [27], CD4+ T cell–specific IL-4Rα knockout mice were generated to elucidate the role of IL-4Rα–mediated signaling in CD4+ T cells independently of non-CD4+ T cell populations. Our results demonstrate a successful generation of transgene-bearing hemizygous LckcreIL-4Rα−/lox BALB/c mice that have effective deletion of IL-4Rα on CD4+ T cells, an incomplete deletion on CD8+ T cells and other T cell subpopulations, and normal expression on non–T cells. LckcreIL-4Rα−/lox mice infected with L. major developed a healing disease phenotype and clinical immunity similar to genetically resistant C57BL/6 mice. Consequently, our studies demonstrate that impairment of IL-4Rα–dependent Th2 polarized CD4+ T cells in the presence of IL-4/IL-13–responsive non-CD4+ T cells is required to transform nonhealer BALB/c mice to a healer phenotype.

Results Top

Genotypic and Phenotypic Characterization of LckcreIL-4Rα−/lox BALB/c Mice

Recently established IL-4Rαlox/lox BALB/c mice [24] were intercrossed with BALB/c mice expressing Cre-recombinase under control of the T cell–specific promoter Lck [28] and IL-4Rα−/− BALB/c mice [20] to generate LckcreIL-4Rα−/lox mice (Figure 1A). IL-4Rα hemizygosity (−/lox) increases probability of Cre-mediated deletion of the “floxed” allele [24]. LckcreIL-4Rα−/lox mice were identified by PCR genotyping (Figure 1B). Fluorescence-activated cell sorter (FACS) analysis of IL-4Rα surface expression confirmed efficient deletion on CD3+CD4+ T cells from LckcreIL-4Rα−/lox mice when compared with IL-4Rα−/− and IL-4Rα−/lox BALB/c (WT) controls (geometric mean channel florescence [geo. mean]: WT = 18.11, IL-4Rα−/− = 8.5, LckcreIL-4Rα−/lox = 9.48), but incomplete and variable deletion efficiency was observed on CD8+ T cells (Figure 1C and Figure S1) (geo. mean: WT = 18.69, IL-4Rα−/− = 9.06, LckcreIL-4Rα−/lox = 13.96) and γδ+ (geo. mean: WT = 7.6, IL-4Rα−/− = 3.15, LckcreIL-4Rα−/lox = 6.72) and NK–T cells (geo. mean: WT = 9.03, IL-4Rα−/− = 5.25, LckcreIL-4Rα−/lox = 7.28; Figure 1C). The cellular specificity of IL-4Rα deletion was confirmed because B cells (CD19+), macrophages, and dendritic cells (DCs; Figure 1C) of LckcreIL-4Rα−/lox mice maintained expression of IL-4Rα. Efficiency of deletion of IL-4Rα in CD4+ T cells was analyzed at the genomic level by quantitative real-time PCR. The number of exon 5 alleles (both present in all cells) relative to exon 8 alleles (deleted in −/−, one copy in −/lox mice) of IL-4Rα was determined in CD4+ T cells sorted to high purity. As expected, exon 8 was efficiently deleted in CD4+ T cells and B cells from IL-4Rα−/− mice (Figure 1D). Confirming FACS analysis, efficient deletion of lox-p–flanked IL-4Rα exon 8 was observed in CD4+ T cells from LckcreIL-4Rα−/lox mice. Analysis revealed 0.114 copies of exon 8 were retained relative to exon 5, equating to 95.48% ± 5.8% deletion efficiency of exon 8 within the CD4+ T cell population. In agreement, no CD4+ T cell exon 8 product was visible following 75 PCR cycles (Figure 1D). An equivalent ratio of exon 8 versus exon 5 was maintained in CD19+ B cells in LckcreIL-4Rα−/lox mice compared with WT controls. These data provide evidence of efficient deletion of IL-4Rα in CD4+ T cells from LckcreIL-4Rα−/lox BALB/c mice.

thumbnail

Figure 1. Generation of LckcreIL-4Rα−/lox Mice

(A) Mouse breeding strategy. IL-4Rαlox/lox BALB/c mice were intercrossed with transgenic BALB/c mice expressing Cre-recombinase under control of the Lck promoter and IL-4Rα−/− BALB/c mice to generate LckcreIL-4Rα−/lox mice. The “loxed” IL-4Rα allele, gray arrows; deleted allele, black arrows.

(B) Genotyping of LckcreIL-4Rα−/lox mice. The deleted IL-4Rα PCR yields a product of 471 bp, LoxP, 188 bp (loxed), and 94 bp (WT), and Cre-specific a 450-bp product.

(C) Phenotypic analysis. WT (solid line), IL-4Rα−/− (gray line), and LckcreIL-4Rα−/lox BALB/c mice (dashed line) LN cells were stained for expression of IL-4Rα. T cell subsets were identified using anti-CD3, anti-CD4/CD8, or δ-TCR. B cells, anti-CD19. DCs, CD11c/I-Ad. Macrophages, F4/80/I-Ad.

(D) Efficiency of IL-4Rα deletion. The ratio of IL-4Rα exon 5 and exon 8 alleles was determined by real-time PCR from genomic DNA purified from CD4+ or CD19+ cells. PCR products of amplified genomic DNA from real-time PCR reactions (75 cycles) were visualized on agarose gel. Data is representative of 2 independent experiments with triplicate values ± SD.

doi:10.1371/journal.ppat.0030068.g001

CD4+ T Cell–Specific Abrogation of IL-4Rα Function

IL-4 promotes proliferation of naive CD4+ T cells in vitro [29]. In order to assess functional impairment of IL-4Rα on CD4+ T cells from LckcreIL-4Rα−/lox mice, naive CD4+ T cells were stimulated with IL-4, and proliferation was measured by [3H] thymidine incorporation (Figure 2A). CD4+ T cells isolated from naive LckcreIL-4Rα−/lox BALB/c mice were unable to proliferate in response to IL-4, as were those from IL-4Rα−/− mice. In contrast, WT CD4+ T cells showed dose-responsive proliferative responses to IL-4. Impairment of IL-4 signaling was IL-4Rα specific, as proliferative responses to IL-2, which shares a γc-chain with the type I IL-4R, were unaffected in all three strains (Figure 2A). Impairment of CD4+ T cell IL-4 responsiveness was further verified using the Th cell differentiation assay. Th1 versus Th2 differentiation of noncommitted CD4+ T cells may be achieved in vitro by treatment with either IL-12/anti–IL-4 or IL-4/anti–IFN-γ, respectively [29]. Naive CD4+ T cells stimulated with anti-CD3/CD28 and polarized with cytokine/neutralizing mAb treatment demonstrate that Th2 polarization, indicated by IL-4 production, was impaired in LckCreIL-4Rα−/lox and IL-4Rα−/− but not WT mice (Figure 2B). As expected, Th1 polarization was achieved in all three strains.

thumbnail

Figure 2. Functional Analysis of LckcreIL-4Rα−/lox Mice

(A) Impaired proliferation in response to IL-4. [3H] thymidine incorporation by CD4+ T cells stimulated by serial dilutions of rIL-4 (left panel) or IL-2 (right panel). One of three representative experiments is shown with means of triplicate values ± SD.

(B) Impaired Th2 differentiation of CD4+ T cells. CD4+ T cells were cultured in Th1 or Th2 polarizing conditions and IL-4 or IFN-γ secretion was measured by ELISA. A representative of one of three experiments is shown with means of triplicate values ± SD.

(C) IL-4 and IL-13 suppress macrophage NO secretion in LckcreIL-4Rα−/lox mice. Peritoneal exudate cells were incubated with IL-4, IL-13, or IL-10 in combination with LPS/IFN-γ, LPS/IFN-γ alone, or medium alone. Nitrite levels were measured by Griess reaction. One of three experiments is shown with means of triplicate values ± SD. (**p < 0.01 or ***p < 0.001, LPS/IFN-γ versus LPS/IFN-γ + IL-4 or IL-13)

(D) IgE production. Total IgE was measured in sera taken at 3 wk after infection and boosted with OVA (three mice per group). One representative experiment of two is shown.

doi:10.1371/journal.ppat.0030068.g002

Functional macrophage IL-4Rα data from LckcreIL-4Rα−/lox mice were demonstrated in Figure 2C. NO production was suppressed by IL-4 and IL-13 in macrophages from LckcreIL-4Rα−/lox and WT mice (Figure 2C), but not IL-4Rα−/− macrophages, showing IL-4Rα specificity. As a positive control, IL-10 suppressed NO production in all three strains. Production of IgE antibodies is strictly dependent on IL-4 signaling [30]. IL-4Rα responsiveness of B cells in LckcreIL-4Rα−/lox mice was demonstrated in Figure 2D. Antigen-induced IgE antibody was present at slightly reduced levels in OVA-immunized LckcreIL-4Rα−/lox mice when compared with those of WT mice, while IgE production was completely abrogated in IL-4Rα−/− mice (Figure 2D). Together, these data provide evidence for effective impairment of IL-4Rα–mediated functions in LckcreIL-4Ra−/lox CD4+ T cells, but not in other lymphocyte subpopulations such as B cells and macrophages.

Resistance to Acute and Chronic Leishmaniasis in LckcreIL-4Rα−/lox BALB/c Mice

Controversy remains as to whether IL-4 [6,20,21] and/or IL-4Rα signaling [20,31] are key components of susceptibility to L. major infection. Polarized Th2 cells certainly play a significant role in contributing to susceptibility [32]. To investigate the consequence of CD4+ T cell–specific IL-4Rα unresponsiveness in leishmaniasis, mice were infected subcutaneously with 2 × 106 stationary phase metacyclic promastigotes of L. major LV39 (MRHO/SV/59/P; Figure 3A). As expected, WT mice developed rapidly growing nonhealing lesions (Figure 3A) within 12 wks of infection and were unable to control parasite burden with high parasite numbers in the footpads (Figure 3B) and LNs (Figure 3C). IL-4Rα−/− mice initially controlled infection with intermediate parasite load in the draining lymph nodes (LNs) and footpad. However, as previously described [20], global IL-4Rα deficiency does not confer resistance to L. major infection, as the mice progressed to develop necrotic lesions in the chronic phase (Figure 3A). In contrast, LckcreIL-4Rα−/lox mice were able to resolve infection with lesion growth comparable with resistant C57BL/6 mice (Figure 3A). LckcreIL-4Rα−/lox mice carried low parasite burdens in the footpad, with approximately 2,000-fold less parasites in the footpad compared with that of WT 6 wk after infection (Figure 3B), and maintained an intermediate parasite burden in the draining LNs when compared with C57BL/6 and WT mice (Figure 3C). Resistance to L. major infection in CD4+ T cell–specific IL-4Rα–deficient mice was profound, as parasite load in the footpad was equivalent to that observed in C57BL/6 mice at 36 wk after infection using PCR to detect kinetoplast DNA at the lesion site (Figure 3D). LckcreIL-4Rα−/lox mice were also shown to be resistant to reinfection. At 6 wk after L. major infection, mice were reinfected in the contralateral footpad. LckcreIL-4Rα−/lox mice were again comparable with genetically resistant C57BL/6 mice in lesion development, while L. major reinfection in WT mice progressed to necrosis in acute phase (Figure 3E). LckcreIL-4Rα−/lox mice were also resistant to the more virulent L. major (MHOM/IL/81/FEBNI) strain (Figure 3F), again with lesion kinetics comparable with that of C57BL/6 mice.

thumbnail

Figure 3. LckcreIL-4Rα−/lox Mice Control Footpad Swelling and Parasite Burden during Acute and Chronic L. major Infection

(A) Lesion development. Footpad swelling was measured at weekly intervals in mice (five per group) infected with 2 × 106 stationary phase L. major LV39 (MRHO/SV/59/P) metacyclic promastigotes into the hind footpad. Asterisk indicates ulceration or necrosis/mouse. A representative of one of five experiments is shown with mean values ± SD.

(B) Week six footpad parasite load. Parasite load was determined by limiting dilution of single-cell suspensions from homogenized footpads at 6 wk after infection.

(C) Week six LN parasite load. Parasite load was determined by limiting dilution of single-cell suspensions from the draining LNs at 6 wk after infection.

(D) L. major parasite detection using real-time PCR at 36 wk after infection. Kinetoplast DNA was quantified from footpads at week 36 after infection. One of two representative experiments is shown, with values representing mean parasite number ± SD.

(E) LckcreIL-4Rα−/lox BALB/c mice are resistant to reinfection. At 6 wk after infection with L. major, mice were reinfected in the contralateral hind footpad, and footpad swelling was monitored for 18 wk. Data are representative of two independent experiments.

(F) LckcreIL-4Rα−/lox BALB/c mice are resistant to L. major (MHOM/IL/81/FEBNI). Lesion development: mice (four per group) were infected with 2 × 106 stationary phase L. major (MHOM/IL/81/FEBNI) metacyclic promastigotes into the hind footpad. Asterisk indicates ulceration or necrosis per mouse. Footpad swelling was measured at weekly intervals up to week 14 and every 2 wk thereafter. A representative of one of two experiments is shown with mean values ± SD.

doi:10.1371/journal.ppat.0030068.g003

Susceptibility to L. major Is Associated with IL-10 Production

IL-10 is a highly immunosuppressive cytokine, profoundly reducing NO production by macrophages (Figure 2C) [33], and is a susceptibility factor in L. major infection [31]. Intracellular cytokine staining revealed increased numbers of antigen-specific CD4+ IL-10–secreting T cells in the draining LNs of WT mice compared with C57BL/6 and LckcreIL-4Rα−/lox mice (Figure 4A and 4B). In order to examine an in vivo correlate demonstrating IL-10 inhibition of protective parasite specific responses, IL-12/IFN-γ–driven delayed type hypersensitivity (DTH) responses were investigated in L. major–infected mice. C57BL/6 develop sustained footpad swelling when challenged with soluble L. major antigen (SLA; Figure 4C), and LckcreIL-4Rα−/lox mice showed intermediate sustained swelling, whereas minimal DTH responses were observed in WT mice (Figure 4C). As expected, addition of IL-10 to SLA diminished DTH responses in all mice (Figure 4D). Neutralization of IL-10 function by blockade of IL-10R lifted suppression of the DTH in the low-responder WT mice on a par with DTH responses observed in the resistant strains (Figure 4E). Confirming that increased DTH responses observed in LckcreIL-4Rα−/lox mice resulted from increased Th1 responses, significant levels of IL-12p70 (Figure 4F) and IFN-γ (Figure 4G) were detected in footpad lysates taken from resistant mice, while little or no IL-12p70 or IFN-γ were induced in susceptible WT mice (Figure 4F and 4G).

thumbnail

Figure 4. IL-10 Inhibits Protective Responses

(A and B) Increased numbers of IL-10–secreting cells in IL-4Rα−/lox mice. (A) CD4+ IL-10–secreting cells were identified by intracellular FACS in LN cells restimulated with SLA for 24 h in vitro from L. major–infected mice 6 wk after infection. Data represent one of two independent experiments (pool of eight popliteal LNs/group). (B) Total numbers of CD4+ IL-10–secreting cells per draining LN.

(C–E) Susceptible mice exhibit poor DTH responses controlled by IL-10. At 6–8 wk after infection with L. major, mice (five mice per group) were injected in the contralateral hind footpad with (C) 10 μg SLA subcutaneously, (D) 10 μg SLA and 0.5 μg IL-10 subcutaneously, and (E) 10 μg SLA and 1.5 μg anti–IL-10R subcutaneously. Footpad swelling was monitored every 24 h for 5 d. (***p < 0.001, **p < 0.01 LckcreIL-4Rα−/lox versus WT). The data represent one of two independent experiments.

(F) Increased IL-12p70 in DTH footpads of resistant mice. Lysates of footpads (four per group) taken 24 h after induction of DTH responses were analyzed for IL-12p70. The data represent the pool of two independent experiments (*p < 0.05, LckcreIL-4Rα−/lox versus WT).

(G) Increased IFN-γ in DTH footpads of resistant mice. Lysates of footpads (four per group) taken 24 h after induction of DTH responses were analyzed for IFN-γ. The data represent the pool of two independent experiments (**p < 0.01, LckcreIL-4Rα−/lox versus WT).

doi:10.1371/journal.ppat.0030068.g004

Increased Type 1 Responses in LckcreIL-4Rα−/lox BALB/c Mice

IL-12 is a key protective cytokine involved in inducing protective responses following L. major infection [34]. We therefore examined IL-12 expression in LckcreIL-4Rα−/lox mice. Although IL-12p35 mRNA production was equivalent at 1 wk after infection (unpublished data), levels of IL-12p35 mRNA were increased in draining LNs of LckcreIL-4Rα−/lox and C57BL/6 mice at 3 wk after infection when compared with those of WT mice (Figure 5A). Levels of IL-12p35 mRNA increased from 1 wk to 3 wk after infection in resistant mice while remaining low in susceptible mice (Figure 5B). IFN-γ–driven iNOS production by macrophages is a key control mechanism in L. major infection [35]. CD4 T cell antigen–specific IFN-γ cytokine production was therefore examined. CD4 T cells from LckcreIL-4Rα−/lox mice induced 2.5-, 1.6-, and 2-fold more IFN-γ when compared with those from IL-4Rα−/− and WT or IL-4Rα−/lox mice at 10, 6, and 12 wk after infection (Figure 5C), respectively. Furthermore, greater IFN-γ levels were detected in footpad homogenates from infected LckcreIL-4Rα−/lox compared with WT mice at 10 wk after infection (Figure 5D). Importantly, IL-4Rα–independent IL-4 production was observed in LckcreIL-4Rα−/lox mice with similar levels of IL-4 production being observed in WT and LckcreIL-4Rα−/lox mice in antigen-specific CD4+ T cell restimulation (Figure 5E) and footpad lysates (Figure 5F). Consistently increased IFN-γ production had an influence on downstream macrophage effector functions. This was shown at 6 wk after infection, when more copies of iNOS mRNA/parasite were observed in resistant strains of mice (Figure 5G). Together, these data demonstrate that resistance to acute leishmaniasis in LckcreIL-4Rα−/lox mice is associated with an early induction of increased protective type 1 immunity and reduced suppression of responses by IL-10–secreting CD4+ T cells.

thumbnail

Figure 5. Type 1 Immunity Is Enhanced in LckcreIL-4Rα−/lox Mice in Response to L. major Infection

(A and B) IL-12p35 mRNA expression is increased in resistant mice. IL-12p35 expression was determined by real-time RT-PCR from RNA prepared from pooled popliteal LN cells from week 3 L. major–infected mice (eight mice per group). Data are expressed as IL-12p35 copy numbers relative to GAPDH (A) or as fold increase in IL-12p35 mRNA from 3 wk versus 1 wk after infection (B). Mean ± SEM of three runs on the same sample. Data are representative of two independent experiments (*p < 0.05, LckcreIL-4Rα−/lox versus WT).

(C and D) Increased IFN-γ production in resistant mice. (C) IFN-γ secretion by CD4 T cells cultured with fixed APCs and SLA. (**p < 0.01, LckcreIL-4Rα−/lox versus WT) and in (D) footpad homogenates (*p < 0.05, LckcreIL-4Rα−/lox versus WT) (homogenate data represent the pool of two independent experiments) from week 10 L. major–infected mice.

(E and F) Maintained IL-4 production in resistant mice. (E) IL-4 secretion by CD4 T cells cultured with fixed APCs and SLA and in (F) footpad homogenates from week-ten L. major–infected mice.

(G) iNOS production. iNOS mRNA copy number was calculated from footpad mRNA 6 wk after infection with L. major. At the same time, parasite DNA copy number was quantitated by PCR detecting L. major kinetoplast DNA. (*p < 0.05 LckcreIL-4Rα−/lox versus WT). The data represent the means of two individual experiments ± SEM.

doi:10.1371/journal.ppat.0030068.g005

Discussion Top

IL-4 and IL-13 share a common signaling pathway through the IL-4Rα chain [26], and as such the combined role of both cytokines can be studied in vivo in IL-4Rα−/− mice. While IL-4 mediates multiple effects on T cells, murine T and B cells do not respond to IL-13 [7]. Generation of CD4+ T cell–specific IL-4Rα–deficient (LckcreIL-4Rα−/lox) mice therefore allows investigation into the role of IL-4 signaling specifically on CD4+ T cells while maintaining IL-4/IL-13–mediated functions on non-CD4+ T cells. CD4+ T cell–specific IL-4Rα–deficient BALB/c mice were generated using the Cre/LoxP recombination system in BALB/c embryonic stem cells. Previous studies have shown efficiency of cell-specific Cre-mediated gene disruption may vary between 38%–85% depending on recombinase efficiency and promoter activity [36]. Efficiency of CD4+ T cell–specific IL-4Rα disruption (95.48%) was increased by using hemizygous WT mice instead of IL-4Rαlox/lox as mating partners for transgenic LckCre mice, thereby reducing the LoxP substrate for Cre-recombinase by 50%. FACS analysis showed efficient disruption of IL-4Rα gene expression in CD4+ T cells and incomplete deletion in CD8+ and NK–T cells with variable deletion efficiency. γδ T cells and non–T cells retained unaltered receptor expression in LckcreIL-4Rα−/lox mice. The data suggest that while the Lck promoter is functional and mediates deletion of loxP-flanked DNA sequences in CD4+, CD8+, and NK–T cell subsets, deletion is more efficient in CD4+ T cells using this promoter construct. Functional analysis further demonstrated effective and specific impairment of the IL-4 responsiveness of CD4 T cells, while B cells and macrophages retained IL-4– and IL-13–mediated functions. Thus, LckcreIL-4Rα−/lox mice are CD4+ T cell–specific IL-4Rα knockout mice, whereas all other cell types remain responsive to IL-4/IL-13.

LckcreIL-4Rα−/lox mice infected with L. major developed similar kinetics of lesion development and resolution as those observed in C57BL/6 mice genetically resistant to two strains of L. major. In contrast, control IL-4Rα−/lox (WT) and IL-4Rα−/− BALB/c mice developed progressive lesion swelling leading to necrosis during the acute and chronic phases of disease as expected. LckcreIL-4Rα−/lox BALB/c and C57BL/6 mice also resisted secondary parasite challenge, unlike WT mice, which showed no signs of footpad pathology. A similar resistant phenotype to L. major infection was also noted in an independent line of mice in which IL-4Rα is efficiently deleted from CD4, CD8, NK–T, and γδ T cells (unpublished data), indicating that IL-4–responsive CD4+ T cells control susceptibility to L. major infection, and that the resistant phenotype is not associated with Cre activity in T cells or hypothetical mutations introduced by the transgene. Together, our study demonstrates that clinical immunity can be achieved in mice on a susceptible BALB/c background by abrogating IL-4Rα responsiveness on CD4+ T cells while retaining IL-4/IL-13–mediated function on non-CD4+ T cells.

IL-10 is a potent suppressor of macrophage activation [37], can abolish IFN-γ/LPS–induced killing of L. major by macrophages [38,39], and can suppress development of DTH responses [40]. In agreement, L. major–infected C57BL/6 and LckcreIL-4Rα−/lox mice developed DTH responses to SLA, inhibited by coadministration of IL-10. In contrast, DTH responses in WT mice were absent. Neutralization of IL-10 signaling allowed WT mice to mount a significant response to SLA. Together, DTH data demonstrated that IL-10 produced in response to SLA in susceptible mice was able to suppress protective cell-mediated immune responses.

IL-10 production is increased in BALB/c mice compared with resistant mice [41], can regulate parasite survival in resistant C57BL/6 mice [1,42], and is a susceptibility factor for L. major infection [31,39]. In agreement, the draining LNs of infected resistant LckcreIL-4Rα−/lox and C57BL/6 mice contained reduced numbers of CD4+ IL-10–secreting cells (4- and 9-fold less, respectively) compared with WT mice. Variable amounts of IL-10 staining were observed in the non-CD4+ T cell population; however, this was found to be nonspecific (Figure 4A). Increased IL-10 secretion was also observed in anti-CD3–stimulated CD4+ T cells derived from WT mice compared with T cells derived from LckcreIL-4Rα−/lox and C57BL/6 mice (not shown). IL-10 production by macrophages [43] and CD4+ T cells [31] has been linked to susceptibility to L. major infection. Using our assay system, IL-10–secreting cells were identified as CD4+ T cells. IL-10–producing CD4+ T cells have been implicated in controlling L. major parasite survival/infection in genetically resistant C57BL/6 mice. CD4+CD25+FoxP3+ IL-10–producing natural T regulatory cells (Tregs) have been elegantly shown to control parasite survival [44,45]. More recently, a novel disease controlling FoxP3 IL-10/IFN-γ–coproducing Th1 cell population has been identified [46]. The role for Tregs in control of L. major is unclear in BALB/c mice and potentially obscured by the predominant polarized Th2 response. The moderately specific method of Treg depletion using anti-CD25 antibody has produced contradictory results either enhancing [47] or reducing [48] susceptibility to L. major infection. Certainly, IL-4 has the ability to enhance the proliferation and function of CD4+CD25+ T cells in BALB/c mice [49,50]. However, the generation of CD4+FoxP3+ T cells was unaffected by IL-4Rα deficiency (unpublished data). Therefore, while not excluding a role for macrophage IL-10 production [43], our data suggest that IL-10 is predominantly produced by activated/effector T cells or Tregs, and further characterization of the CD4+IL-10+ T cells is ongoing.

The absence of IL-4Rα specifically on CD4+ T cells resulted in consistently higher levels of IFN-γ secretion by CD4+ T cells compared with WT mice. However, as previously shown, induction of increased IFN-γ responses alone does not guarantee control of L. major infection. Substantially increased L. major–specific CD4+ T cell IFN-γ production was observed in macrophage/neutrophil-specific IL-4Rα–deficient mice when compared with WT controls. However, infection also induced a potent polarized Th2 response, and lesion development was delayed but uncontrolled [9]. In contrast, in the absence of a polarized Th2 response, increased IFN-γ production correlated with protection against infection in LckcreIL-4Rα−/lox and C57BL/6 mice. Significant DTH responses upon injection of SLA into the footpad were observed as early as 3 wk after infection in LckcreIL-4Rα−/lox and C57BL/6 mice, but not in WT mice (unpublished data). Sustained tuberculin-like DTH responses are driven by IL-12–induced IFN-γ–producing Th1 cells [34,51], resulting in macrophage recruitment and activation, and are indicative of protective cell-mediated immune responses against intracellular pathogens. This was confirmed by increased IL-12 protein detected in tissue lysate of footpads of resistant mice compared with WT mice 24 h after DTH induction. Furthermore, increased levels of IFN-γ secretion were associated with increased expression of iNOS mRNA/parasite in infected footpads. Together, these results demonstrate that in the absence of IL-4Rα signaling on CD4 T cells, a polarized Th2 response, and IL-10 production, protective Th1 immune responses during cutaneous leishmaniasis result in effective macrophage activation and intracellular parasite elimination.

IL-4Rα−/− mice are susceptible to L. major infection in the acute [31] or the chronic [20] phase. Despite the absence of Th1 downregulatory signals through the IL-4Rα, IL-4Rα−/− mice do not produce increased amounts of IFN-γ following L. major infection when compared with WT controls [7]. Resistance to L. major in LckcreIL-4Rα−/lox mice has therefore revealed the protective role of IL-4/IL-13–responsive non-CD4+ T cells in control of infection in BALB/c mice. Crucial to resistance in LckcreIL-4Rα−/lox mice is CD4+ T cell IL-4Rα–independent IL-4 production. Not only induced following L. major infection [7,31] in IL-4Rα−/− mice, IL-4Rα–independent IL-4 production has been observed in response to Nippostrongylus brasiliensis [52] and Schistosoma mansoni [53] infections and following immunization with protein precipitated in alum [54]. As our study suggests, IL-4Rα–independent IL-4 production in LckcreIL-4Rα−/lox mice drives the induction of protective responses by non-CD4+ T cells. Both IL-4 and IL-13 are able to indirectly promote protective Th1 responses. Elegant experiments have demonstrated that IL-4 is able to instruct DCs to produce IL-12 and subsequent protection from L. major infection in BALB/c mice [55]. Furthermore, IL-4 is required for protective type 1 responses to Candida [56]. IL-13 can prime monocytes for IL-12 production [57] and drive protective cell-mediated immune responses during listeriosis [58]. Indeed, levels of IL-12p35 mRNA were increased in draining LNs of LckcreIL-4Rα−/lox and C57BL/6 mice by 3 wk after infection (Figure 5A), coincident with increased DTH responses (unpublished data). As macrophage IL-12 production is actively downregulated by L. major [18], it is likely that increased IL-12p35 mRNA levels in the LNs at 3 wk after infection were produced by DCs. In agreement, infected DCs appear in draining LNs in two waves; the first transient wave peaks at 24 h, and the second commences 15–21 d after L. major infection [59]. Therefore, IL-4Rα–independent IL-4 production and subsequent IL-12 production by DCs in the absence of Th2 polarization may explain the protection of LckcreIL-4Rα−/lox from L. major infection. Furthermore, the protective effect of IL-4 signaling in non-CD4+ T cells may also explain the requirement for IL-4 in effective treatments against visceral leishmaniasis [60,61].

In summary, in the absence of a polarized Th2 response where non-CD4+ T cells retain IL-4/IL-13 responsiveness, increased protective immune responses are induced by 3 wk in LckcreIL-4Rα−/lox mice. As IL-12 may also negate Treg cell action on activated T cells [62], this regulation is likely to enhance beneficial Th1 responses and immunity following L. major infection in LckcreIL-4Rα−/lox mice, possibly reflecting a similar scenario in the healer C57Bl/6. In contrast, IL-4Rα expression on CD4+ T cells allows Th2 polarization and induction of IL-10 production in the nonhealer BALB/c strain. As a consequence, Th1 responses and protective macrophage effector functions are downregulated, IL-10 is upregulated, and subsequently, BALB/c mice succumb to L. major infection in the acute phase. In conclusion, where CD4+ T cells are unable to respond to IL-4, IL-4/IL-13 signaling in non-CD4+ T cells is beneficial in BALB/c mice following infection with L. major.

Materials and Methods Top

Generation and genotyping of LckcreIL-4Rα−/lox BALB/c mice.

Transgenic Lckcre mice [28] back-crossed to BALB/c for nine generations were intercrossed with IL-4Rα−/− and IL-4Rαlox/lox mice to generate LckcreIL-4Rα−/lox BALB/c mice. WT littermates were used as controls in all experiments. Mice were genotyped as described previously [24]. All mice were housed in specific pathogen–free barrier conditions at the University of Cape Town, South Africa, and used in accordance with University ethical committee guidelines. All experimental mice were age and sex matched and used between 8–12 wk of age.

Analysis of IL-4Rα deletion efficiency.

DNA was prepared from CD3+CD4+ and CD19+ sorted LN cells from LckcreIL-4Rα−/lox, WT, or IL-4Rα−/− mice using a FACsvantage flow cytometer (BD, http://www.bd.com) to >99% purity. A standard curve was prepared from serial 10-fold DNA dilutions of cloned IL-4Rα exon 5 and exon 8 DNA. Primers: exon 5 forward 5′ AACCTGGGAAGTTGTG 3′, exon 5 reverse 5′ CACAGTTCCATCTGGTAT 3′; exon 8 forward 5′ GTACAGCGCACATTGTTTTT 3′, exon 8 reverse 5′ CTCGGCGCACTGACCCATCT 3′.

Detection of parasite DNA.

DNA was prepared from homogenized tissues samples. A DNA standard curve was prepared from serial 10-fold parasite DNA dilutions in PBS. L. major kinetoplast primers used: forward 5′ CGCCTCCGAGCCCAAAAATG 3′ and reverse 5′ GATTATGGGTGGGCGTTCTG 3′. Real-time PCR amplification and data analysis performed using the “Fit Points” and “Standard Curve” methods as described previously [63].

Flow cytometry.

IL-4Rα was detected by anti-IL-4Rα–PE (M-1; BD), and leukocyte subpopulations were identified using anti-CD19 (1D3), anti–δ-TCR (GL3), anti-CD11c (HL3), anti-F4/80, anti–I-Ad (AMS-32.1), anti-CD11b (M1/70) (all from BD), anti-CD3 (145–2C11), anti-CD4 (GK1.5), and anti-CD8 (53.6.72) mAbs, which were purified from hybridoma supernatants by protein G sepharose (Amersham Biosciences, http://www.amersham.com) and labeled with FITC or biotin. Biotin-labeled antibodies were detected by streptavidin–allophycocyanin (BD). Dead cells were stained by 7-AAD and excluded from analysis (Sigma, http://www.sigmaaldrich.com). Acquisition was performed using FACSCalibur, and data were analyzed by Cellquest (BD).

T cell proliferation.

CD4+ T cells, positively selected by anti-CD4 Dynabeads (Invitrogen, http://www.invitrogen.com) to a purity of >85% as described [7], were stimulated with serial dilutions of IL-4, IL-13, or IL-2 (BD) in complete IMDM containing 10% FCS, penicillin, and streptomycin, 1 mM sodium pyruvate, NEAA (Invitrogen), 10 mM HEPES, and 50 μM β2-ME (Sigma). After 48 h of incubation at 37 °C and 5% CO2, cells were pulsed with 1 μCi (0.037 MBq) [3H] thymidine (Amersham Biosciences) for a further 18 h. [3H] incorporation was measured in a liquid scintillation counter.

In vitro Th2 differentiation.

In vitro Th1/Th2 differentiation of purified CD4+ T cells was induced as described previously [7].

Suppression of macrophage-derived NO secretion.

Suppression assay was performed as described [20]. Briefly, adherent macrophages derived from peritoneal exudate cells elicited with 3% Brewers thioglycollate (Difco Laboratories, http://www.bd.com/ds) were incubated for 16 h with medium or with IL-4, IL-13, or IL-10 at 1,000 U/ml (R&D Systems, http://www.rndsystems.com). Cells were subsequently stimulated with LPS (15 ng/ml; Sigma) and IFN-γ (100 U/ml; BD) and NO was measured by Griess reaction after 48 h.

Induction of IgE response.

Mice were immunized subcutaneously with 10 μg of OVA in CFA (Sigma) and boosted at 7 and 14 d with OVA intraperitoneally. IgE production was detected as described previously [20].

L. major infection.

L. major LV39 (MRHO/SV/59/P) and MHOM/IL/81/FEBNI strains were maintained by continuous passage in BALB/c mice and cultured in vitro as described previously [20]. Mice were inoculated subcutaneously with 2 × 106 stationary phase metacyclic promastigotes into the left hind footpad in a volume of 50 μl HBSS (Invitrogen). Swelling was monitored every week up to a maximum of 40 wk using a Mitutoyo pocket thickness gauge (http://www.mitutoyo.com). For reinfection studies, 6 wk after primary infection, mice were injected subcutaneously with 2 × 106 stationary phase metacyclic promastigotes into the contralateral footpad. Footpad swelling was monitored for 18 wk.

Detection of viable parasite burden.

Infected organ cell suspensions were cultured in Schneider's culture medium (Sigma). Parasite burden was estimated according to a previously described limiting dilution method [20].

Quantification of iNOS and IL-12p35 RNA.

Total RNA from footpad or LN was purified using mini-elute columns (Qiagen, http://www.qiagen.com) and cDNA was generated using the Inprom-II re-verse transcription system (Promega, http://www.promega.com). Primers pairs used to detect IL-12p35 message: forward 5′-GATGACATGGTGAAGACGGCC-3′, and reverse 5′-GGAGGTTTCTGGCGCAGAGT-3′. iNOS message forward 5′-AGCTCCTCCCAGGACCACAC-3′, and reverse 5′-ACGCTGAGTAC CTCATTGGC-3′. Data analysis was performed using the “Fit Points” and “Standard Curve” methods using beta-2-microglobulin as a housekeeping gene.

DTH reaction.

Mice were inoculated subcutaneously with 10 μg SLA into the right hind footpad alone or with 0.5 μg mouse rIL-10 or 1.5 μg anti–IL-10Rα (R&D Systems). Footpad swelling was measured every 24 h. Footpads were homogenized, and lysates were taken 24 h after induction of DTH.

Antigen-specific restimulation.

CD4+ T cells were positively selected using anti-CD4 Macs beads (Miltenyi Biotec, http://www.miltenyibiotec.com) to a purity of >90% according to the manufacturer's instructions. Thy1.2-labeled splenocytes were T cell depleted by complement-mediated lysis (Cedarlane, http://www.cedarlanelabs.com) to produce antigen-presenting cells (APCs). APCs fixed with mitomycin C (50 μg/ml, 20 min at 37 °C) and washed extensively in complete IMDM. A total of 2 × 105 purified CD4+ T cells and 1 × 105 APCs were cultured with SLA at 50 μg/ml, supernatants were collected after 48 h, and cytokines were analyzed as previously described [20].

Cytokine detection in tissue homogenates.

IFN-γ and IL-4 were detected in footpad tissues using the method previously described [24].

Intracellular staining.

L. major–infected mice; popliteal LN cells at 2 × 105 cells/well were stimulated with SLA (5 μg/ml) for 24 h. Cultures were supplemented with monensin (2 μM) for the final 4 h of culture. Cells were stained with anti-CD4 FITC (mAb, GK1.5), fixed, permeabilized, and stained with anti–IL-10 APCs (BD).

Statistics.

Values are given as mean ± SD and significant differences were determined using Student's t test (Prism software, http://www.prism-software.com).

Supporting Information Top

Figure S1. Variable Deletion Efficiency of IL-4Rα on CD8+ T Cells

WT (black line), IL-4Rα−/− (gray line), and LckcreIL-4Rα−/lox BALB/c mice (dashed line) peripheral blood lymphocytes were stained for expression of IL-4Rα. CD8+ T cells were identified using anti-CD3 and anti-CD8.

(30 KB PDF)

Acknowledgments Top

The authors would like to thank L. Fick, R. Peterson, and E. Smith for their assistance. SM is a holder of senior postdoctoral fellowship of Foundation for Scientific Research Flanderen, Belgium (FWO). FB is holder of a Wellcome Trust Research Senior Fellowship for Medical Science in RSA. FB, JA, and PK hold a collaborative Wellcome Trust grant. FB and JA hold a collaborative programme grant from the Royal Society (United Kingdom) and NRF (Republic of South Africa).

Author Contributions Top

MR, AJC, and FB conceived and designed the experiments. MR, AJC, JCH, SM, CH, AB, and BA performed the experiments. MR, AJC, JCH, SM, and RK analyzed the data. TH contributed reagents. MR, AJC, JA, PK, and FB wrote the paper.

References Top

  1. Sacks D, Noben-Trauth N (2002) The immunology of susceptibility and resistance to Leishmania major in mice. Nat Rev Immunol 2: 845–858. Find this article online
  2. Locksley RM, Scott P (1991) Helper T-cell subsets in mouse leishmaniasis: Induction, expansion and effector function. Immunol Today 12: A58–A61. Find this article online
  3. Reiner SL, Locksley RM (1995) The regulation of immunity to Leishmania major. Annu Rev Immunol 13: 151–177. Find this article online
  4. Matthews DJ, Emson CL, McKenzie GJ, Jolin HE, Blackwell JM, et al. (2000) IL-13 is a susceptibility factor for Leishmania major infection. J Immunol 164: 1458–1462. Find this article online
  5. Arendse B, Van Snick J, Brombacher F (2005) IL-9 is a susceptibility factor in Leishmania major infection by promoting detrimental Th2/type 2 responses. J Immunol 174: 2205–2211. Find this article online
  6. Kopf M, Brombacher F, Kohler G, Kienzle G, Widmann KH, et al. (1996) IL-4–deficient Balb/c mice resist infection with Leishmania major. J Exp Med 184: 1127–1136. Find this article online
  7. Mohrs M, Holscher C, Brombacher F (2000) Interleukin-4 receptor alpha-deficient BALB/c mice show an unimpaired T helper 2 polarization in response to Leishmania major infection. Infect Immun 68: 1773–1780. Find this article online
  8. Iniesta V, Gomez-Nieto LC, Molano I, Mohedano A, Carcelen J, et al. (2002) Arginase I induction in macrophages, triggered by Th2-type cytokines, supports the growth of intracellular Leishmania parasites. Parasite Immunol 24: 113–118. Find this article online
  9. Holscher C, Arendse B, Schwegmann A, Myburgh E, Brombacher F (2006) Impairment of alternative macrophage activation delays cutaneous leishmaniasis in nonhealing BALB/c mice. J Immunol 176: 1115–1121. Find this article online
  10. Laskay T, Diefenbach A, Rollinghoff M, Solbach W (1995) Early parasite containment is decisive for resistance to Leishmania major infection. Eur J Immunol 25: 2220–2227. Find this article online
  11. Heinzel FP, Schoenhaut DS, Rerko RM, Rosser LE, Gately MK (1993) Recombinant interleukin 12 cures mice infected with Leishmania major. J Exp Med 177: 1505–1509. Find this article online
  12. Sypek JP, Chung CL, Mayor SE, Subramanyam JM, Goldman SJ, et al. (1993) Resolution of cutaneous leishmaniasis: Interleukin 12 initiates a protective T helper type 1 immune response. J Exp Med 177: 1797–1802. Find this article online
  13. Park AY, Hondowicz B, Kopf M, Scott P (2002) The role of IL-12 in maintaining resistance to Leishmania major. J Immunol 168: 5771–5777. Find this article online
  14. Guler ML, Gorham JD, Hsieh CS, Mackey AJ, Steen RG, et al. (1996) Genetic susceptibility to Leishmania: IL-12 responsiveness in TH1 cell development. Science 271: 984–987. Find this article online
  15. Scott P, Natovitz P, Coffman RL, Pearce E, Sher A (1988) Immunoregulation of cutaneous leishmaniasis. T cell lines that transfer protective immunity or exacerbation belong to different T helper subsets and respond to distinct parasite antigens. J Exp Med 168: 1675–1684. Find this article online
  16. Morris L, Troutt AB, Handman E, Kelso A (1992) Changes in the precursor frequencies of IL-4 and IFN-gamma secreting CD4+ cells correlate with resolution of lesions in murine cutaneous leishmaniasis. J Immunol 149: 2715–2721. Find this article online
  17. Belkaid Y, Mendez S, Lira R, Kadambi N, Milon G, et al. (2000) A natural model of Leishmania major infection reveals a prolonged “silent” phase of parasite amplification in the skin before the onset of lesion formation and immunity. J Immunol 165: 969–977. Find this article online
  18. Reiner SL, Zheng S, Wang ZE, Stowring L, Locksley RM (1994) Leishmania promastigotes evade interleukin 12 (IL-12) induction by macrophages and stimulate a broad range of cytokines from CD4+ T cells during initiation of infection. J Exp Med 179: 447–456. Find this article online
  19. Sadick MD, Heinzel FP, Holaday BJ, Pu RT, Dawkins RS, et al. (1990) Cure of murine leishmaniasis with anti–interleukin 4 monoclonal antibody. Evidence for a T cell–dependent, interferon gamma–independent mechanism. J Exp Med 171: 115–127. Find this article online
  20. Mohrs M, Ledermann B, Kohler G, Dorfmuller A, Gessner A, et al. (1999) Differences between IL-4- and IL-4 receptor alpha-deficient mice in chronic leishmaniasis reveal a protective role for IL-13 receptor signaling. J Immunol 162: 7302–7308. Find this article online
  21. Noben-Trauth N, Kropf P, Muller I (1996) Susceptibility to Leishmania major infection in interleukin-4–deficient mice. Science 271: 987–990. Find this article online
  22. McKenzie GJ, Emson CL, Bell SE, Anderson S, Fallon P, et al. (1998) Impaired development of Th2 cells in IL-13–deficient mice. Immunity 9: 423–432. Find this article online
  23. Zurawski G, de Vries JE (1994) Interleukin 13, an interleukin 4–like cytokine that acts on monocytes and B cells, but not on T cells. Immunol Today 15: 19–26. Find this article online
  24. Herbert DR, Holscher C, Mohrs M, Arendse B, Schwegmann A, et al. (2004) Alternative macrophage activation is essential for survival during schistosomiasis and downmodulates T helper 1 responses and immunopathology. Immunity 20: 623–635. Find this article online
  25. Kelly-Welch AE, Hanson EM, Boothby MR, Keegan AD (2003) Interleukin-4 and interleukin-13 signaling connections maps. Science 300: 1527–1528. Find this article online
  26. Nelms K, Keegan AD, Zamorano J, Ryan JJ, Paul WE (1999) The IL-4 receptor: Signaling mechanisms and biologic functions. Annu Rev Immunol 17: 701–738. Find this article online
  27. Swain SL, Weinberg AD, English M, Huston G (1990) IL-4 directs the development of Th2-like helper effectors. J Immunol 145: 3796–3806. Find this article online
  28. Gu H, Marth JD, Orban PC, Mossmann H, Rajewsky K (1994) Deletion of a DNA polymerase beta gene segment in T cells using cell type–specific gene targeting. Science 265: 103–106. Find this article online
  29. Seder RA, Paul WE (1994) Acquisition of lymphokine-producing phenotype by CD4+ T cells. Annu Rev Immunol 12: 635–673. Find this article online
  30. Shimoda K, van Deursen J, Sangster MY, Sarawar SR, Carson RT, et al. (1996) Lack of IL-4–induced Th2 response and IgE class switching in mice with disrupted Stat6 gene. Nature 380: 630–633. Find this article online
  31. Noben-Trauth N, Lira R, Nagase H, Paul WE, Sacks DL (2003) The relative contribution of IL-4 receptor signaling and IL-10 to susceptibility to Leishmania major. J Immunol 170: 5152–5158. Find this article online
  32. Heinzel FP, Rerko RM (1999) Cure of progressive murine leishmaniasis: Interleukin 4 dominance is abolished by transient CD4(+) T cell depletion and T helper cell type 1–selective cytokine therapy. J Exp Med 189: 1895–1906. Find this article online
  33. Gazzinelli RT, Oswald IP, James SL, Sher A (1992) IL-10 inhibits parasite killing and nitrogen oxide production by IFN-gamma–activated macrophages. J Immunol 148: 1792–1796. Find this article online
  34. Mattner F, Magram J, Ferrante J, Launois P, Di Padova K, et al. (1996) Genetically resistant mice lacking interleukin-12 are susceptible to infection with Leishmania major and mount a polarized Th2 cell response. Eur J Immunol 26: 1553–1559. Find this article online
  35. Stenger S, Thuring H, Rollinghoff M, Bogdan C (1994) Tissue expression of inducible nitric oxide synthase is closely associated with resistance to Leishmania major. J Exp Med 180: 783–793. Find this article online
  36. Rajewsky K, Gu H, Kuhn R, Betz UA, Muller W, et al. (1996) Conditional gene targeting. J Clin Invest 98: 600–603. Find this article online
  37. Bogdan C, Vodovotz Y, Nathan C (1991) Macrophage deactivation by interleukin 10. J Exp Med 174: 1549–1555. Find this article online
  38. Vieth M, Will A, Schroppel K, Rollinghoff M, Gessner A (1994) Interleukin-10 inhibits antimicrobial activity against Leishmania major in murine macrophages. Scand J Immunol 40: 403–409. Find this article online
  39. Kane MM, Mosser DM (2001) The role of IL-10 in promoting disease progression in leishmaniasis. J Immunol 166: 1141–1147. Find this article online
  40. Li L, Elliott JF, Mosmann TR (1994) IL-10 inhibits cytokine production, vascular leakage, and swelling during T helper 1 cell–induced delayed-type hypersensitivity. J Immunol 153: 3967–3978. Find this article online
  41. Heinzel FP, Sadick MD, Mutha SS, Locksley RM (1991) Production of interferon gamma, interleukin 2, interleukin 4, and interleukin 10 by CD4+ lymphocytes in vivo during healing and progressive murine leishmaniasis. Proc Natl Acad Sci U S A 88: 7011–7015. Find this article online
  42. Belkaid Y, Hoffmann KF, Mendez S, Kamhawi S, Udey MC, et al. (2001) The role of interleukin (IL)-10 in the persistence of Leishmania major in the skin after healing and the therapeutic potential of anti–IL-10 receptor antibody for sterile cure. J Exp Med 194: 1497–1506. Find this article online
  43. Miles SA, Conrad SM, Alves RG, Jeronimo SM, Mosser DM (2005) A role for IgG immune complexes during infection with the intracellular pathogen Leishmania. J Exp Med 201: 747–754. Find this article online
  44. Suffia IJ, Reckling SK, Piccirillo CA, Goldszmid RS, Belkaid Y (2006) Infected site-restricted Foxp3+ natural regulatory T cells are specific for microbial antigens. J Exp Med 203: 777–788. Find this article online
  45. Belkaid Y, Piccirillo CA, Mendez S, Shevach EM, Sacks DL (2002) CD4+CD25+ regulatory T cells control Leishmania major persistence and immunity. Nature 420: 502–507. Find this article online
  46. Anderson CF, Oukka M, Kuchroo VJ, Sacks D (2007) CD4+CD25Foxp3 Th1 cells are the source of IL-10–mediated immune suppression in chronic cutaneous leishmaniasis. J Exp Med 204: 285–297. Find this article online
  47. Aseffa A, Gumy A, Launois P, MacDonald HR, Louis JA, et al. (2002) The early IL-4 response to Leishmania major and the resulting Th2 cell maturation steering progressive disease in BALB/c mice are subject to the control of regulatory CD4+CD25+ T cells. J Immunol 169: 3232–3241. Find this article online
  48. Xu D, Liu H, Komai-Koma M, Campbell C, McSharry C, et al. (2003) CD4+CD25+ regulatory T cells suppress differentiation and functions of Th1 and Th2 cells, Leishmania major infection, and colitis in mice. J Immunol 170: 394–399. Find this article online
  49. Thornton AM, Piccirillo CA, Shevach EM (2004) Activation requirements for the induction of CD4+CD25+ T cell suppressor function. Eur J Immunol 34: 366–376. Find this article online
  50. Pace L, Rizzo S, Palombi C, Brombacher F, Doria G (2006) Cutting edge: IL-4–induced protection of CD4+CD25 Th cells from CD4+CD25+ regulatory T cell–mediated suppression. J Immunol 176: 3900–3904. Find this article online
  51. Cher DJ, Mosmann TR (1987) Two types of murine helper T cell clone. II. Delayed-type hypersensitivity is mediated by TH1 clones. J Immunol 138: 3688–3694. Find this article online
  52. Barner M, Mohrs M, Brombacher F, Kopf M (1998) Differences between IL-4R alpha-deficient and IL-4–deficient mice reveal a role for IL-13 in the regulation of Th2 responses. Curr Biol 8: 669–672. Find this article online
  53. Jankovic D, Kullberg MC, Noben-Trauth N, Caspar P, Paul WE, et al. (2000) Single cell analysis reveals that IL-4 receptor/Stat6 signaling is not required for the in vivo or in vitro development of CD4+ lymphocytes with a Th2 cytokine profile. J Immunol 164: 3047–3055. Find this article online
  54. Brewer JM, Conacher M, Hunter CA, Mohrs M, Brombacher F, et al. (1999) Aluminium hydroxide adjuvant initiates strong antigen-specific Th2 responses in the absence of IL-4– or IL-13–mediated signaling. J Immunol 163: 6448–6454. Find this article online
  55. Biedermann T, Zimmermann S, Himmelrich H, Gumy A, Egeter O, et al. (2001) IL-4 instructs TH1 responses and resistance to Leishmania major in susceptible BALB/c mice. Nat Immunol 2: 1054–1060. Find this article online
  56. Mencacci A, Del Sero G, Cenci E, d'Ostiani CF, Bacci A, et al. (1998) Endogenous interleukin 4 is required for development of protective CD4+ T helper type 1 cell responses to Candida albicans. J Exp Med 187: 307–317. Find this article online
  57. Minty A, Ferrara P, Caput D (1997) Interleukin-13 effects on activated monocytes lead to novel cytokine secretion profiles intermediate between those induced by interleukin-10 and by interferon-gamma. Eur Cytokine Netw 8: 189–201. Find this article online
  58. Flesch IE, Wandersee A, Kaufmann SH (1997) Effects of IL-13 on murine listeriosis. Int Immunol 9: 467–474. Find this article online
  59. Iezzi G, Frohlich A, Ernst B, Ampenberger F, Saeland S, et al. (2006) Lymph node resident rather than skin-derived dendritic cells initiate specific T cell responses after Leishmania major infection. J Immunol 177: 1250–1256. Find this article online
  60. Alexander J, Carter KC, Al-Fasi N, Satoskar A, Brombacher F (2000) Endogenous IL-4 is necessary for effective drug therapy against visceral leishmaniasis. Eur J Immunol 30: 2935–2943. Find this article online
  61. Stager S, Alexander J, Kirby AC, Botto M, Rooijen NV, et al. (2003) Natural antibodies and complement are endogenous adjuvants for vaccine-induced CD8+ T-cell responses. Nat Med 9: 1287–1292. Find this article online
  62. King IL, Segal BM (2005) Cutting edge: IL-12 induces CD4+CD25 T cell activation in the presence of T regulatory cells. J Immunol 175: 641–645. Find this article online
  63. Nicolas L, Prina E, Lang T, Milon G (2002) Real-time PCR for detection and quantitation of leishmania in mouse tissues. J Clin Microbiol 40: 1666–1669. Find this article online
Post Your Note (For Public Viewing)
Compose Your Note
 
Declare any competing interests.
Add a note to this text.
Please follow our guidelines for notes and comments and review our competing interests policy. Comments that do not conform to our guidelines will be promptly removed and the user account disabled. The following must be avoided:
  • Remarks that could be interpreted as allegations of misconduct
  • Unsupported assertions or statements
  • Inflammatory or insulting language
Add a note to this text.
You must be logged in to add a note to an article. You may log in by clicking here or cancel this note.
Add a note to this text.
You cannot annotate this area of the document. Close
Add a note to this text.
You cannot create an annotation that spans different sections of the document; please adjust your selection.
Close
Rate This Article
Please follow our guidelines for rating and review our competing interests policy. Comments that do not conform to our guidelines will be promptly removed and the user account disabled. The following must be avoided:
  1. Remarks that could be interpreted as allegations of misconduct
  2. Unsupported assertions or statements
  3. Inflammatory or insulting language
Compose Your Annotation
 
Declare any competing interests.

All site content, except where otherwise noted, is licensed under a Creative Commons Attribution License.